FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641587_at:

>probe:Drosophila_2:1641587_at:601:353; Interrogation_Position=110; Antisense; GCAGCCTCATCCAGCAAACGGTTGA
>probe:Drosophila_2:1641587_at:77:581; Interrogation_Position=14; Antisense; TGGCGGGCCCACTTTTGTGGCAAAA
>probe:Drosophila_2:1641587_at:123:629; Interrogation_Position=173; Antisense; TCCGGTTCAGCATGTACGGTGGTCT
>probe:Drosophila_2:1641587_at:319:141; Interrogation_Position=188; Antisense; ACGGTGGTCTGTTTGTTGCTCCTAC
>probe:Drosophila_2:1641587_at:264:531; Interrogation_Position=224; Antisense; GGGTCAAGATTTCCAGCGCCATGTG
>probe:Drosophila_2:1641587_at:7:65; Interrogation_Position=244; Antisense; ATGTGGCCGCAGACATCGTTGAGGA
>probe:Drosophila_2:1641587_at:600:443; Interrogation_Position=318; Antisense; GATGACCTGCTTCTACTTTATCATG
>probe:Drosophila_2:1641587_at:187:699; Interrogation_Position=334; Antisense; TTTATCATGAGCCTCCTGGAGTCCA
>probe:Drosophila_2:1641587_at:507:393; Interrogation_Position=393; Antisense; GAAATTCCTGCCCACGTACAAGGTG
>probe:Drosophila_2:1641587_at:500:665; Interrogation_Position=409; Antisense; TACAAGGTGGCTCTGTCCGTATGGC
>probe:Drosophila_2:1641587_at:46:533; Interrogation_Position=479; Antisense; GGGTGCCATTCATCAGCGCGTGCAG
>probe:Drosophila_2:1641587_at:621:729; Interrogation_Position=523; Antisense; TTGGCCTACATGAAGCACCTGGAGC
>probe:Drosophila_2:1641587_at:277:341; Interrogation_Position=59; Antisense; GCTACCCGATTATGCGCGGCATGAT
>probe:Drosophila_2:1641587_at:72:569; Interrogation_Position=76; Antisense; GGCATGATATCGTACAGCCTGATCT

Paste this into a BLAST search page for me
GCAGCCTCATCCAGCAAACGGTTGATGGCGGGCCCACTTTTGTGGCAAAATCCGGTTCAGCATGTACGGTGGTCTACGGTGGTCTGTTTGTTGCTCCTACGGGTCAAGATTTCCAGCGCCATGTGATGTGGCCGCAGACATCGTTGAGGAGATGACCTGCTTCTACTTTATCATGTTTATCATGAGCCTCCTGGAGTCCAGAAATTCCTGCCCACGTACAAGGTGTACAAGGTGGCTCTGTCCGTATGGCGGGTGCCATTCATCAGCGCGTGCAGTTGGCCTACATGAAGCACCTGGAGCGCTACCCGATTATGCGCGGCATGATGGCATGATATCGTACAGCCTGATCT

Full Affymetrix probeset data:

Annotations for 1641587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720