FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641588_at:

>probe:Drosophila_2:1641588_at:497:643; Interrogation_Position=113; Antisense; TCTCCGTGCCGAGCAGCAAGTGAAT
>probe:Drosophila_2:1641588_at:524:719; Interrogation_Position=139; Antisense; TTGACGGCTTTGCTTACGCTGTTGA
>probe:Drosophila_2:1641588_at:654:333; Interrogation_Position=156; Antisense; GCTGTTGAGCTGGACAACTCTGTCA
>probe:Drosophila_2:1641588_at:258:89; Interrogation_Position=16; Antisense; AGTTAGCCTTCTCAAGTCTTTCAAC
>probe:Drosophila_2:1641588_at:383:249; Interrogation_Position=179; Antisense; CAATGTGCAACAGAAGGGTGACCTT
>probe:Drosophila_2:1641588_at:574:221; Interrogation_Position=225; Antisense; AAGGGAAGCCAGTCGTGGACATCTC
>probe:Drosophila_2:1641588_at:379:501; Interrogation_Position=236; Antisense; GTCGTGGACATCTCCCGAAAATGTG
>probe:Drosophila_2:1641588_at:674:387; Interrogation_Position=252; Antisense; GAAAATGTGCCAGTGTCCATCCAAT
>probe:Drosophila_2:1641588_at:670:21; Interrogation_Position=275; Antisense; ATATATCGCCGATGCCAACGGTTAC
>probe:Drosophila_2:1641588_at:361:77; Interrogation_Position=292; Antisense; ACGGTTACCAGGTGGTGTCTGCCAA
>probe:Drosophila_2:1641588_at:486:247; Interrogation_Position=341; Antisense; AATTCCAGAGGCCATCCAGCGTTCT
>probe:Drosophila_2:1641588_at:259:121; Interrogation_Position=358; Antisense; AGCGTTCTCTGGAGTACATCGCCGC
>probe:Drosophila_2:1641588_at:63:615; Interrogation_Position=49; Antisense; TGAAGTTCTTCATTGCTTTCGCCTG
>probe:Drosophila_2:1641588_at:122:137; Interrogation_Position=97; Antisense; ACGAAGATGCCAATGTTCTCCGTGC

Paste this into a BLAST search page for me
TCTCCGTGCCGAGCAGCAAGTGAATTTGACGGCTTTGCTTACGCTGTTGAGCTGTTGAGCTGGACAACTCTGTCAAGTTAGCCTTCTCAAGTCTTTCAACCAATGTGCAACAGAAGGGTGACCTTAAGGGAAGCCAGTCGTGGACATCTCGTCGTGGACATCTCCCGAAAATGTGGAAAATGTGCCAGTGTCCATCCAATATATATCGCCGATGCCAACGGTTACACGGTTACCAGGTGGTGTCTGCCAAAATTCCAGAGGCCATCCAGCGTTCTAGCGTTCTCTGGAGTACATCGCCGCTGAAGTTCTTCATTGCTTTCGCCTGACGAAGATGCCAATGTTCTCCGTGC

Full Affymetrix probeset data:

Annotations for 1641588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720