Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641590_at:

>probe:Drosophila_2:1641590_at:268:635; Interrogation_Position=3775; Antisense; TCGAGAAACCCAACACGGATGATTT
>probe:Drosophila_2:1641590_at:24:249; Interrogation_Position=3808; Antisense; AATTGAGAGCCAAGCGAGCCACTAA
>probe:Drosophila_2:1641590_at:528:431; Interrogation_Position=3861; Antisense; GAGTCAACAAATGCCGCTCAAGAGG
>probe:Drosophila_2:1641590_at:202:575; Interrogation_Position=3884; Antisense; GGCGGACGATGATGCATTTAACTTC
>probe:Drosophila_2:1641590_at:703:705; Interrogation_Position=3906; Antisense; TTCAACTCGGAGGACTATCGTGCCC
>probe:Drosophila_2:1641590_at:371:263; Interrogation_Position=4020; Antisense; CAGCGTGCACGTCGCGTTAATGTAA
>probe:Drosophila_2:1641590_at:569:719; Interrogation_Position=4045; Antisense; TTGACTCGGATAGCGACAACGACGA
>probe:Drosophila_2:1641590_at:70:531; Interrogation_Position=4126; Antisense; GGGATTCTGGCCACATGGATGCCAA
>probe:Drosophila_2:1641590_at:272:629; Interrogation_Position=4145; Antisense; TGCCAATGCCGAGGAGGACAGCGAT
>probe:Drosophila_2:1641590_at:180:547; Interrogation_Position=4172; Antisense; GGAGGCCAACTTTTTGGCTCGCAAA
>probe:Drosophila_2:1641590_at:245:207; Interrogation_Position=4227; Antisense; AAGCGGCGTCGGTTGGCCATCATCG
>probe:Drosophila_2:1641590_at:241:603; Interrogation_Position=4268; Antisense; TGATTTTTAATGCACACCCGTTCTG
>probe:Drosophila_2:1641590_at:475:133; Interrogation_Position=4283; Antisense; ACCCGTTCTGCTCTTGATTTTATAG
>probe:Drosophila_2:1641590_at:413:459; Interrogation_Position=4298; Antisense; GATTTTATAGCTCACCGGAATGGAA

Paste this into a BLAST search page for me
TCGAGAAACCCAACACGGATGATTTAATTGAGAGCCAAGCGAGCCACTAAGAGTCAACAAATGCCGCTCAAGAGGGGCGGACGATGATGCATTTAACTTCTTCAACTCGGAGGACTATCGTGCCCCAGCGTGCACGTCGCGTTAATGTAATTGACTCGGATAGCGACAACGACGAGGGATTCTGGCCACATGGATGCCAATGCCAATGCCGAGGAGGACAGCGATGGAGGCCAACTTTTTGGCTCGCAAAAAGCGGCGTCGGTTGGCCATCATCGTGATTTTTAATGCACACCCGTTCTGACCCGTTCTGCTCTTGATTTTATAGGATTTTATAGCTCACCGGAATGGAA

Full Affymetrix probeset data:

Annotations for 1641590_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime