FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641591_at:

>probe:Drosophila_2:1641591_at:166:421; Interrogation_Position=220; Antisense; GAGCACTCCATTAACCAGCAGCGAT
>probe:Drosophila_2:1641591_at:56:425; Interrogation_Position=253; Antisense; GAGATGCACATTGTCCACCGAAATG
>probe:Drosophila_2:1641591_at:262:441; Interrogation_Position=316; Antisense; GATGGCATTGCTGTTATTGGAGTCA
>probe:Drosophila_2:1641591_at:279:239; Interrogation_Position=348; Antisense; AATCAATCCCAATCGCATATTTCCG
>probe:Drosophila_2:1641591_at:489:291; Interrogation_Position=395; Antisense; CGTTGCCGCGGGTGACGAAGTACAA
>probe:Drosophila_2:1641591_at:449:489; Interrogation_Position=414; Antisense; GTACAACGCGAAGACGACCATTCCG
>probe:Drosophila_2:1641591_at:285:273; Interrogation_Position=432; Antisense; CATTCCGGGCGGACTAAGTCTTGGA
>probe:Drosophila_2:1641591_at:451:49; Interrogation_Position=460; Antisense; ATGCTTGGAAACGTGAATCCCCGGG
>probe:Drosophila_2:1641591_at:588:693; Interrogation_Position=521; Antisense; TTTGCGAGCAGTCTGTCACCTGGAC
>probe:Drosophila_2:1641591_at:40:483; Interrogation_Position=568; Antisense; GTACCCTATTCGTCGGTGTCGAAAT
>probe:Drosophila_2:1641591_at:338:561; Interrogation_Position=596; Antisense; GGAAACTGCGAGACTCCGAGGGCCA
>probe:Drosophila_2:1641591_at:261:265; Interrogation_Position=621; Antisense; CAGACTGATCAACAATTTCCGGGAC
>probe:Drosophila_2:1641591_at:663:695; Interrogation_Position=636; Antisense; TTTCCGGGACATACAGCCGCGAAAT
>probe:Drosophila_2:1641591_at:415:229; Interrogation_Position=658; Antisense; AATGGGCGCCCAGTGTTCTACAGGA

Paste this into a BLAST search page for me
GAGCACTCCATTAACCAGCAGCGATGAGATGCACATTGTCCACCGAAATGGATGGCATTGCTGTTATTGGAGTCAAATCAATCCCAATCGCATATTTCCGCGTTGCCGCGGGTGACGAAGTACAAGTACAACGCGAAGACGACCATTCCGCATTCCGGGCGGACTAAGTCTTGGAATGCTTGGAAACGTGAATCCCCGGGTTTGCGAGCAGTCTGTCACCTGGACGTACCCTATTCGTCGGTGTCGAAATGGAAACTGCGAGACTCCGAGGGCCACAGACTGATCAACAATTTCCGGGACTTTCCGGGACATACAGCCGCGAAATAATGGGCGCCCAGTGTTCTACAGGA

Full Affymetrix probeset data:

Annotations for 1641591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720