FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641593_at:

>probe:Drosophila_2:1641593_at:538:231; Interrogation_Position=1018; Antisense; AATCCGCTTGTAGTTGTCGGGACCG
>probe:Drosophila_2:1641593_at:128:289; Interrogation_Position=1065; Antisense; CGGATCCGACGTTCACCAGAATAAA
>probe:Drosophila_2:1641593_at:617:395; Interrogation_Position=1105; Antisense; GAAATTGAACTGCTGCTTTTCGCTT
>probe:Drosophila_2:1641593_at:598:321; Interrogation_Position=1175; Antisense; GCGCTTGGTCCACTTACAGAATGTC
>probe:Drosophila_2:1641593_at:104:109; Interrogation_Position=1192; Antisense; AGAATGTCACGTGCGTTTTCGTAGT
>probe:Drosophila_2:1641593_at:570:697; Interrogation_Position=1207; Antisense; TTTTCGTAGTAGTAGCACTCCGTGC
>probe:Drosophila_2:1641593_at:198:235; Interrogation_Position=1254; Antisense; AATGCCTTTGATGAGCGTGTCCAGC
>probe:Drosophila_2:1641593_at:53:599; Interrogation_Position=1271; Antisense; TGTCCAGCTCGTCGAATTTAGCCAG
>probe:Drosophila_2:1641593_at:76:117; Interrogation_Position=1294; Antisense; AGCTTCATGTTGACTTGGTCGCGGA
>probe:Drosophila_2:1641593_at:139:331; Interrogation_Position=1314; Antisense; GCGGAAATCCTGCTCGAACTTGAAT
>probe:Drosophila_2:1641593_at:333:93; Interrogation_Position=1409; Antisense; AGTTGCCCATGTCCGTGGTCTGGAA
>probe:Drosophila_2:1641593_at:679:391; Interrogation_Position=1440; Antisense; GAAATGCAAGGAGCCGCGTCTTTTG
>probe:Drosophila_2:1641593_at:138:703; Interrogation_Position=1460; Antisense; TTTTGCGTATCTCGACATTGTCCAT
>probe:Drosophila_2:1641593_at:327:55; Interrogation_Position=990; Antisense; ATGAAGAGCAGTCTTACCTCGTGCC

Paste this into a BLAST search page for me
AATCCGCTTGTAGTTGTCGGGACCGCGGATCCGACGTTCACCAGAATAAAGAAATTGAACTGCTGCTTTTCGCTTGCGCTTGGTCCACTTACAGAATGTCAGAATGTCACGTGCGTTTTCGTAGTTTTTCGTAGTAGTAGCACTCCGTGCAATGCCTTTGATGAGCGTGTCCAGCTGTCCAGCTCGTCGAATTTAGCCAGAGCTTCATGTTGACTTGGTCGCGGAGCGGAAATCCTGCTCGAACTTGAATAGTTGCCCATGTCCGTGGTCTGGAAGAAATGCAAGGAGCCGCGTCTTTTGTTTTGCGTATCTCGACATTGTCCATATGAAGAGCAGTCTTACCTCGTGCC

Full Affymetrix probeset data:

Annotations for 1641593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720