FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641596_at:

>probe:Drosophila_2:1641596_at:539:717; Interrogation_Position=138; Antisense; TTCCGACAGCGAAGTCCTGCCGGCG
>probe:Drosophila_2:1641596_at:2:625; Interrogation_Position=14; Antisense; TGCGACGCCGCGAACTGCAGACCAT
>probe:Drosophila_2:1641596_at:271:397; Interrogation_Position=142; Antisense; GACAGCGAAGTCCTGCCGGCGACCT
>probe:Drosophila_2:1641596_at:12:115; Interrogation_Position=169; Antisense; AGCAGCGTTCCAGCTGTTCTCCTGG
>probe:Drosophila_2:1641596_at:290:603; Interrogation_Position=183; Antisense; TGTTCTCCTGGCCAGCGGCAAGAAC
>probe:Drosophila_2:1641596_at:223:263; Interrogation_Position=195; Antisense; CAGCGGCAAGAACCTGGACGATGAC
>probe:Drosophila_2:1641596_at:339:409; Interrogation_Position=211; Antisense; GACGATGACGCCGACAAGTCAGAGC
>probe:Drosophila_2:1641596_at:501:411; Interrogation_Position=217; Antisense; GACGCCGACAAGTCAGAGCCCACAA
>probe:Drosophila_2:1641596_at:121:619; Interrogation_Position=29; Antisense; TGCAGACCATCCAGCTGAAGCTGTC
>probe:Drosophila_2:1641596_at:543:413; Interrogation_Position=33; Antisense; GACCATCCAGCTGAAGCTGTCCGAT
>probe:Drosophila_2:1641596_at:568:137; Interrogation_Position=68; Antisense; ACGAGCAGGCTAAGATGGAGCGCCT
>probe:Drosophila_2:1641596_at:582:439; Interrogation_Position=81; Antisense; GATGGAGCGCCTGAGGAACCGCCAA
>probe:Drosophila_2:1641596_at:685:437; Interrogation_Position=93; Antisense; GAGGAACCGCCAACAATTGCTTACT
>probe:Drosophila_2:1641596_at:379:561; Interrogation_Position=95; Antisense; GGAACCGCCAACAATTGCTTACTCC

Paste this into a BLAST search page for me
TTCCGACAGCGAAGTCCTGCCGGCGTGCGACGCCGCGAACTGCAGACCATGACAGCGAAGTCCTGCCGGCGACCTAGCAGCGTTCCAGCTGTTCTCCTGGTGTTCTCCTGGCCAGCGGCAAGAACCAGCGGCAAGAACCTGGACGATGACGACGATGACGCCGACAAGTCAGAGCGACGCCGACAAGTCAGAGCCCACAATGCAGACCATCCAGCTGAAGCTGTCGACCATCCAGCTGAAGCTGTCCGATACGAGCAGGCTAAGATGGAGCGCCTGATGGAGCGCCTGAGGAACCGCCAAGAGGAACCGCCAACAATTGCTTACTGGAACCGCCAACAATTGCTTACTCC

Full Affymetrix probeset data:

Annotations for 1641596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720