FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641598_at:

>probe:Drosophila_2:1641598_at:349:393; Interrogation_Position=1425; Antisense; GAAAGATGGCACCACTTGCAGTGAT
>probe:Drosophila_2:1641598_at:454:85; Interrogation_Position=1444; Antisense; AGTGATCCCATTAACGCTGCTCGTT
>probe:Drosophila_2:1641598_at:304:597; Interrogation_Position=1486; Antisense; TGTGCGGCGGTGGACATTACATCGA
>probe:Drosophila_2:1641598_at:672:693; Interrogation_Position=1537; Antisense; TTTCCCAGTGGACATGCTAGCTTCG
>probe:Drosophila_2:1641598_at:373:669; Interrogation_Position=1567; Antisense; TACTCCATGCTCTACTTGGTGATTT
>probe:Drosophila_2:1641598_at:13:95; Interrogation_Position=1619; Antisense; AGTTGAGAATGCTGTGCCACCTGCT
>probe:Drosophila_2:1641598_at:699:619; Interrogation_Position=1652; Antisense; TGCTGCTCATGTTCGCCTGGTATAC
>probe:Drosophila_2:1641598_at:10:591; Interrogation_Position=1669; Antisense; TGGTATACGGCTCTCACCAGAGTTT
>probe:Drosophila_2:1641598_at:210:99; Interrogation_Position=1687; Antisense; AGAGTTTCCGACTACAAGCACCATT
>probe:Drosophila_2:1641598_at:407:209; Interrogation_Position=1702; Antisense; AAGCACCATTGGTCCGATGTCTTGG
>probe:Drosophila_2:1641598_at:317:77; Interrogation_Position=1728; Antisense; AGGATCTGGCATCGGACTGACCTAC
>probe:Drosophila_2:1641598_at:670:483; Interrogation_Position=1779; Antisense; GTAGGCTGGATCCTTGACTTTTCGC
>probe:Drosophila_2:1641598_at:435:291; Interrogation_Position=1830; Antisense; CGTGGAGCTGCTTTCGCTTTAAGAT
>probe:Drosophila_2:1641598_at:526:99; Interrogation_Position=1851; Antisense; AGATGTCTTATCTGGCGCAATTTCA

Paste this into a BLAST search page for me
GAAAGATGGCACCACTTGCAGTGATAGTGATCCCATTAACGCTGCTCGTTTGTGCGGCGGTGGACATTACATCGATTTCCCAGTGGACATGCTAGCTTCGTACTCCATGCTCTACTTGGTGATTTAGTTGAGAATGCTGTGCCACCTGCTTGCTGCTCATGTTCGCCTGGTATACTGGTATACGGCTCTCACCAGAGTTTAGAGTTTCCGACTACAAGCACCATTAAGCACCATTGGTCCGATGTCTTGGAGGATCTGGCATCGGACTGACCTACGTAGGCTGGATCCTTGACTTTTCGCCGTGGAGCTGCTTTCGCTTTAAGATAGATGTCTTATCTGGCGCAATTTCA

Full Affymetrix probeset data:

Annotations for 1641598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720