FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641599_at:

>probe:Drosophila_2:1641599_at:389:177; Interrogation_Position=120; Antisense; AAACGGAAAATGTCTGCCCTGCGCC
>probe:Drosophila_2:1641599_at:122:319; Interrogation_Position=142; Antisense; GCCGTGATGTGTCGCCTTTAATCCA
>probe:Drosophila_2:1641599_at:512:697; Interrogation_Position=158; Antisense; TTTAATCCAGCGCATTCGGGCCTTC
>probe:Drosophila_2:1641599_at:120:631; Interrogation_Position=184; Antisense; TCCTGGGTCGGGAGCACAACCTGGC
>probe:Drosophila_2:1641599_at:635:581; Interrogation_Position=205; Antisense; TGGCCCTGCGCTTCGAGGACGGACT
>probe:Drosophila_2:1641599_at:94:559; Interrogation_Position=254; Antisense; GGAAATCCCTGACGGTCCATCGCAT
>probe:Drosophila_2:1641599_at:280:253; Interrogation_Position=26; Antisense; CAAGCAGCTGATATCGATTGGACGA
>probe:Drosophila_2:1641599_at:279:193; Interrogation_Position=291; Antisense; AACTACTACTGCCAGCGGGATGGAC
>probe:Drosophila_2:1641599_at:719:63; Interrogation_Position=310; Antisense; ATGGACGTCGCGAGGTTCTGCCGCC
>probe:Drosophila_2:1641599_at:358:465; Interrogation_Position=41; Antisense; GATTGGACGACAGGGCTGGACCTCA
>probe:Drosophila_2:1641599_at:441:317; Interrogation_Position=429; Antisense; GCCTGGGATTAATGGGCCGCATCAC
>probe:Drosophila_2:1641599_at:668:345; Interrogation_Position=447; Antisense; GCATCACCGCGGGAATCGCCTTTTT
>probe:Drosophila_2:1641599_at:81:693; Interrogation_Position=471; Antisense; TTTGAGTTGTAGTACGAGCCGGTTA
>probe:Drosophila_2:1641599_at:222:83; Interrogation_Position=52; Antisense; AGGGCTGGACCTCACAAATAAATAT

Paste this into a BLAST search page for me
AAACGGAAAATGTCTGCCCTGCGCCGCCGTGATGTGTCGCCTTTAATCCATTTAATCCAGCGCATTCGGGCCTTCTCCTGGGTCGGGAGCACAACCTGGCTGGCCCTGCGCTTCGAGGACGGACTGGAAATCCCTGACGGTCCATCGCATCAAGCAGCTGATATCGATTGGACGAAACTACTACTGCCAGCGGGATGGACATGGACGTCGCGAGGTTCTGCCGCCGATTGGACGACAGGGCTGGACCTCAGCCTGGGATTAATGGGCCGCATCACGCATCACCGCGGGAATCGCCTTTTTTTTGAGTTGTAGTACGAGCCGGTTAAGGGCTGGACCTCACAAATAAATAT

Full Affymetrix probeset data:

Annotations for 1641599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720