FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641600_at:

>probe:Drosophila_2:1641600_at:112:429; Interrogation_Position=332; Antisense; GAGATTCTGGCCAAGCGTAACATGA
>probe:Drosophila_2:1641600_at:77:191; Interrogation_Position=350; Antisense; AACATGAAGCCCGAGGTGCGCAAGG
>probe:Drosophila_2:1641600_at:11:109; Interrogation_Position=411; Antisense; AGAAGCGTGCCGTCAAGGCCGCCAA
>probe:Drosophila_2:1641600_at:126:111; Interrogation_Position=480; Antisense; AGAAGGCCGCCAAGGTCACGCAGAA
>probe:Drosophila_2:1641600_at:424:355; Interrogation_Position=525; Antisense; GCAAGCGGTAAACACCTTTCGCCGG
>probe:Drosophila_2:1641600_at:146:307; Interrogation_Position=539; Antisense; CCTTTCGCCGGTAGTGATGTGCTAA
>probe:Drosophila_2:1641600_at:638:539; Interrogation_Position=574; Antisense; GGATTTAAGGAACCACTCGTGAATT
>probe:Drosophila_2:1641600_at:233:387; Interrogation_Position=599; Antisense; GAAAATTAAACAAACGCCGCGAATG
>probe:Drosophila_2:1641600_at:111:369; Interrogation_Position=619; Antisense; GAATGCGAATTCGTGGTGACCAAAA
>probe:Drosophila_2:1641600_at:191:181; Interrogation_Position=646; Antisense; AAAACTGTCGCGTGTTCTTTCTATC
>probe:Drosophila_2:1641600_at:703:471; Interrogation_Position=659; Antisense; GTTCTTTCTATCAAGCTTGGCTTAC
>probe:Drosophila_2:1641600_at:153:21; Interrogation_Position=714; Antisense; ATATTGTGTACGTCATGAATCATCA
>probe:Drosophila_2:1641600_at:204:265; Interrogation_Position=755; Antisense; CAGTTTTGACCAGATGACAGAGTTT
>probe:Drosophila_2:1641600_at:302:567; Interrogation_Position=802; Antisense; GGCAAATATATACCTTCGAACCATA

Paste this into a BLAST search page for me
GAGATTCTGGCCAAGCGTAACATGAAACATGAAGCCCGAGGTGCGCAAGGAGAAGCGTGCCGTCAAGGCCGCCAAAGAAGGCCGCCAAGGTCACGCAGAAGCAAGCGGTAAACACCTTTCGCCGGCCTTTCGCCGGTAGTGATGTGCTAAGGATTTAAGGAACCACTCGTGAATTGAAAATTAAACAAACGCCGCGAATGGAATGCGAATTCGTGGTGACCAAAAAAAACTGTCGCGTGTTCTTTCTATCGTTCTTTCTATCAAGCTTGGCTTACATATTGTGTACGTCATGAATCATCACAGTTTTGACCAGATGACAGAGTTTGGCAAATATATACCTTCGAACCATA

Full Affymetrix probeset data:

Annotations for 1641600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720