FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641601_at:

>probe:Drosophila_2:1641601_at:456:85; Interrogation_Position=1031; Antisense; AGTGCCCTCACATCAAGTATTTCTC
>probe:Drosophila_2:1641601_at:435:523; Interrogation_Position=534; Antisense; GGGTATTTTTCCTGTCCAACATTAG
>probe:Drosophila_2:1641601_at:585:473; Interrogation_Position=577; Antisense; GTTCAATCTCACTGTCTGGGATCGA
>probe:Drosophila_2:1641601_at:166:145; Interrogation_Position=601; Antisense; ACTGCTGCAGTACGTCCATGAGATG
>probe:Drosophila_2:1641601_at:65:49; Interrogation_Position=648; Antisense; ATGCCTACACCGGATCAATTTACTT
>probe:Drosophila_2:1641601_at:614:709; Interrogation_Position=671; Antisense; TTGCCCCGGGAGCTAAAGTCGAACA
>probe:Drosophila_2:1641601_at:167:185; Interrogation_Position=692; Antisense; AACAGTTGGTTCCTGGAGTTCCAGT
>probe:Drosophila_2:1641601_at:382:423; Interrogation_Position=722; Antisense; GAGAGAACCATGGTGGCCGTACCCA
>probe:Drosophila_2:1641601_at:199:11; Interrogation_Position=797; Antisense; ATTCCCTATGCGGAGGCCTATGTGA
>probe:Drosophila_2:1641601_at:526:135; Interrogation_Position=860; Antisense; ACGCTTCTCAGCGATGTCCGGGAAA
>probe:Drosophila_2:1641601_at:538:387; Interrogation_Position=887; Antisense; GAAAACGCTACTGGTCTACGGTTCT
>probe:Drosophila_2:1641601_at:693:539; Interrogation_Position=906; Antisense; GGTTCTTTGAAGGACTCGACCGCAA
>probe:Drosophila_2:1641601_at:673:649; Interrogation_Position=950; Antisense; TCAAATTCATTTGTCCCCTCAGTAA
>probe:Drosophila_2:1641601_at:342:47; Interrogation_Position=990; Antisense; ATCCGTTAACGTTGCCGATGACTAA

Paste this into a BLAST search page for me
AGTGCCCTCACATCAAGTATTTCTCGGGTATTTTTCCTGTCCAACATTAGGTTCAATCTCACTGTCTGGGATCGAACTGCTGCAGTACGTCCATGAGATGATGCCTACACCGGATCAATTTACTTTTGCCCCGGGAGCTAAAGTCGAACAAACAGTTGGTTCCTGGAGTTCCAGTGAGAGAACCATGGTGGCCGTACCCAATTCCCTATGCGGAGGCCTATGTGAACGCTTCTCAGCGATGTCCGGGAAAGAAAACGCTACTGGTCTACGGTTCTGGTTCTTTGAAGGACTCGACCGCAATCAAATTCATTTGTCCCCTCAGTAAATCCGTTAACGTTGCCGATGACTAA

Full Affymetrix probeset data:

Annotations for 1641601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720