Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641602_at:

>probe:Drosophila_2:1641602_at:360:133; Interrogation_Position=102; Antisense; ACCCAAGTTATGTGTCCTGCGGAAC
>probe:Drosophila_2:1641602_at:111:517; Interrogation_Position=113; Antisense; GTGTCCTGCGGAACTGCAACTGGAA
>probe:Drosophila_2:1641602_at:565:585; Interrogation_Position=133; Antisense; TGGAACTCCACCACGAATGCCTGTG
>probe:Drosophila_2:1641602_at:689:375; Interrogation_Position=15; Antisense; GAAGAGCCTTCTGAGTCTGTCGACA
>probe:Drosophila_2:1641602_at:349:337; Interrogation_Position=170; Antisense; GCTCCAATCTGTGCAATCGCTTTAA
>probe:Drosophila_2:1641602_at:88:699; Interrogation_Position=190; Antisense; TTTAAGAACAGCTGCACCCTGCGAT
>probe:Drosophila_2:1641602_at:375:133; Interrogation_Position=205; Antisense; ACCCTGCGATATGAATCCTGCGTGG
>probe:Drosophila_2:1641602_at:131:593; Interrogation_Position=227; Antisense; TGGGATCCACCACATACACGGCGGT
>probe:Drosophila_2:1641602_at:460:85; Interrogation_Position=253; Antisense; AGTCTGTCCCAGTGTTCCGGGATCA
>probe:Drosophila_2:1641602_at:631:305; Interrogation_Position=323; Antisense; CCTCGTCATCGAATGTTGTACCCAT
>probe:Drosophila_2:1641602_at:139:151; Interrogation_Position=37; Antisense; ACAGTCCTGTTTGTCCTGTCATTCG
>probe:Drosophila_2:1641602_at:588:285; Interrogation_Position=52; Antisense; CTGTCATTCGCGTGTGTGGTCCTGG
>probe:Drosophila_2:1641602_at:540:517; Interrogation_Position=67; Antisense; GTGGTCCTGGCCAACAGCAGTAGCA
>probe:Drosophila_2:1641602_at:612:673; Interrogation_Position=87; Antisense; TAGCAGCAGTTCCACACCCAAGTTA

Paste this into a BLAST search page for me
ACCCAAGTTATGTGTCCTGCGGAACGTGTCCTGCGGAACTGCAACTGGAATGGAACTCCACCACGAATGCCTGTGGAAGAGCCTTCTGAGTCTGTCGACAGCTCCAATCTGTGCAATCGCTTTAATTTAAGAACAGCTGCACCCTGCGATACCCTGCGATATGAATCCTGCGTGGTGGGATCCACCACATACACGGCGGTAGTCTGTCCCAGTGTTCCGGGATCACCTCGTCATCGAATGTTGTACCCATACAGTCCTGTTTGTCCTGTCATTCGCTGTCATTCGCGTGTGTGGTCCTGGGTGGTCCTGGCCAACAGCAGTAGCATAGCAGCAGTTCCACACCCAAGTTA

Full Affymetrix probeset data:

Annotations for 1641602_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime