Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641605_at:

>probe:Drosophila_2:1641605_at:179:249; Interrogation_Position=3244; Antisense; CAATCGGATCAATCTGCTCATCAGG
>probe:Drosophila_2:1641605_at:180:337; Interrogation_Position=3259; Antisense; GCTCATCAGGAGATCACCGACACAA
>probe:Drosophila_2:1641605_at:664:585; Interrogation_Position=3299; Antisense; TGGAACTGGCCCTGGATCGACAGAA
>probe:Drosophila_2:1641605_at:379:245; Interrogation_Position=3327; Antisense; CAATTGCAGCAGATCCGAGTACGGT
>probe:Drosophila_2:1641605_at:715:237; Interrogation_Position=3397; Antisense; AATCTCAATGCCAACTCGAATTCCA
>probe:Drosophila_2:1641605_at:193:635; Interrogation_Position=3412; Antisense; TCGAATTCCAATCCGAATCCCAGTA
>probe:Drosophila_2:1641605_at:386:367; Interrogation_Position=3450; Antisense; GAATCCATCGCAAATCCTGCAGCAT
>probe:Drosophila_2:1641605_at:335:197; Interrogation_Position=3476; Antisense; AACGACGTAGCCGACGTTCCATGAC
>probe:Drosophila_2:1641605_at:36:413; Interrogation_Position=3498; Antisense; GACCCGCGATGATGACAATTTCTAT
>probe:Drosophila_2:1641605_at:707:17; Interrogation_Position=3515; Antisense; ATTTCTATAGCTTCGATAGCGACGA
>probe:Drosophila_2:1641605_at:585:239; Interrogation_Position=3544; Antisense; AATAGCTACTACTCCATTAGTCCCT
>probe:Drosophila_2:1641605_at:491:115; Interrogation_Position=3574; Antisense; AGCAGTCGCTATGTGGTGGAGATCT
>probe:Drosophila_2:1641605_at:601:547; Interrogation_Position=3739; Antisense; TGTAGTTTCGGTAACCAACTTGCGT
>probe:Drosophila_2:1641605_at:230:275; Interrogation_Position=3757; Antisense; CTTGCGTTTTTCGTATGCCCAAATA

Paste this into a BLAST search page for me
CAATCGGATCAATCTGCTCATCAGGGCTCATCAGGAGATCACCGACACAATGGAACTGGCCCTGGATCGACAGAACAATTGCAGCAGATCCGAGTACGGTAATCTCAATGCCAACTCGAATTCCATCGAATTCCAATCCGAATCCCAGTAGAATCCATCGCAAATCCTGCAGCATAACGACGTAGCCGACGTTCCATGACGACCCGCGATGATGACAATTTCTATATTTCTATAGCTTCGATAGCGACGAAATAGCTACTACTCCATTAGTCCCTAGCAGTCGCTATGTGGTGGAGATCTTGTAGTTTCGGTAACCAACTTGCGTCTTGCGTTTTTCGTATGCCCAAATA

Full Affymetrix probeset data:

Annotations for 1641605_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime