Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641607_at:

>probe:Drosophila_2:1641607_at:680:109; Interrogation_Position=1488; Antisense; AGAAGTGGCCTGACACCCAGACGGA
>probe:Drosophila_2:1641607_at:122:355; Interrogation_Position=1530; Antisense; GCACCAATGTGCCAAGTCTTGCCGA
>probe:Drosophila_2:1641607_at:289:399; Interrogation_Position=1553; Antisense; GACACTCTGGTCTGCTATGCTAATA
>probe:Drosophila_2:1641607_at:238:341; Interrogation_Position=1566; Antisense; GCTATGCTAATACGCCGGGCTATGT
>probe:Drosophila_2:1641607_at:223:633; Interrogation_Position=1605; Antisense; TCGACACGGGCAGCTGGTACATCCA
>probe:Drosophila_2:1641607_at:657:537; Interrogation_Position=1620; Antisense; GGTACATCCAGAAGTTTTGCCAAGT
>probe:Drosophila_2:1641607_at:391:221; Interrogation_Position=1641; Antisense; AAGTGATGGCCGATCATGCCCACGA
>probe:Drosophila_2:1641607_at:728:623; Interrogation_Position=1657; Antisense; TGCCCACGACACAGACCTTGAGGAT
>probe:Drosophila_2:1641607_at:143:205; Interrogation_Position=1701; Antisense; AAGCCGTGGGTAATAAGCGCACCAA
>probe:Drosophila_2:1641607_at:703:79; Interrogation_Position=1728; Antisense; AGGGTTCCATGCAGACAGGTGCCTA
>probe:Drosophila_2:1641607_at:554:23; Interrogation_Position=1807; Antisense; ATAGTTGCCGCCACTGGACATTTTA
>probe:Drosophila_2:1641607_at:667:557; Interrogation_Position=1822; Antisense; GGACATTTTATCATTCCGGATGCAT
>probe:Drosophila_2:1641607_at:215:133; Interrogation_Position=1852; Antisense; ACCGCATTTATGTTCTTATCGTCGC
>probe:Drosophila_2:1641607_at:516:677; Interrogation_Position=1892; Antisense; TAGATTATGTGTTCTGTGCTCGCGT

Paste this into a BLAST search page for me
AGAAGTGGCCTGACACCCAGACGGAGCACCAATGTGCCAAGTCTTGCCGAGACACTCTGGTCTGCTATGCTAATAGCTATGCTAATACGCCGGGCTATGTTCGACACGGGCAGCTGGTACATCCAGGTACATCCAGAAGTTTTGCCAAGTAAGTGATGGCCGATCATGCCCACGATGCCCACGACACAGACCTTGAGGATAAGCCGTGGGTAATAAGCGCACCAAAGGGTTCCATGCAGACAGGTGCCTAATAGTTGCCGCCACTGGACATTTTAGGACATTTTATCATTCCGGATGCATACCGCATTTATGTTCTTATCGTCGCTAGATTATGTGTTCTGTGCTCGCGT

Full Affymetrix probeset data:

Annotations for 1641607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime