Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641608_at:

>probe:Drosophila_2:1641608_at:284:369; Interrogation_Position=3515; Antisense; GAATGCATGTACACACTTCTCGAGC
>probe:Drosophila_2:1641608_at:297:153; Interrogation_Position=3527; Antisense; ACACTTCTCGAGCAGGGCTTGGATC
>probe:Drosophila_2:1641608_at:446:513; Interrogation_Position=3552; Antisense; GTGTGGATGTCATGCAGTTCCTGGA
>probe:Drosophila_2:1641608_at:401:445; Interrogation_Position=3616; Antisense; GATGCTGACGTACCTGATGACGGCA
>probe:Drosophila_2:1641608_at:34:57; Interrogation_Position=3632; Antisense; ATGACGGCACGTCTGGCCATCTTGT
>probe:Drosophila_2:1641608_at:315:35; Interrogation_Position=3650; Antisense; ATCTTGTGCCCGGATAAGGTTCTGC
>probe:Drosophila_2:1641608_at:611:223; Interrogation_Position=3665; Antisense; AAGGTTCTGCTAAGACTCGATCAAT
>probe:Drosophila_2:1641608_at:352:671; Interrogation_Position=3702; Antisense; TACGTGATACGTGCACCCACAAGGT
>probe:Drosophila_2:1641608_at:721:79; Interrogation_Position=3723; Antisense; AGGTGAAGGCCAACTCTGTGAAACA
>probe:Drosophila_2:1641608_at:436:75; Interrogation_Position=3762; Antisense; AGGACGAACTCAAGCGTTCTGCCCT
>probe:Drosophila_2:1641608_at:661:575; Interrogation_Position=3799; Antisense; GGCCCTTTCGCAAATACCCAAAGCA
>probe:Drosophila_2:1641608_at:300:33; Interrogation_Position=3831; Antisense; ATCAGCAGTTAGTGGATTTCCTCAA
>probe:Drosophila_2:1641608_at:17:109; Interrogation_Position=3903; Antisense; AGAAGGATTCCATCACCGGTAGCTC
>probe:Drosophila_2:1641608_at:180:481; Interrogation_Position=4001; Antisense; GTTTGCGCACAAACAAGTATCTCTT

Paste this into a BLAST search page for me
GAATGCATGTACACACTTCTCGAGCACACTTCTCGAGCAGGGCTTGGATCGTGTGGATGTCATGCAGTTCCTGGAGATGCTGACGTACCTGATGACGGCAATGACGGCACGTCTGGCCATCTTGTATCTTGTGCCCGGATAAGGTTCTGCAAGGTTCTGCTAAGACTCGATCAATTACGTGATACGTGCACCCACAAGGTAGGTGAAGGCCAACTCTGTGAAACAAGGACGAACTCAAGCGTTCTGCCCTGGCCCTTTCGCAAATACCCAAAGCAATCAGCAGTTAGTGGATTTCCTCAAAGAAGGATTCCATCACCGGTAGCTCGTTTGCGCACAAACAAGTATCTCTT

Full Affymetrix probeset data:

Annotations for 1641608_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime