Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641609_at:

>probe:Drosophila_2:1641609_at:86:295; Interrogation_Position=2464; Antisense; CGATGAGGATGAACTCCCGCAGCAT
>probe:Drosophila_2:1641609_at:596:157; Interrogation_Position=2504; Antisense; ACAACGGAGGAGTCGACCACCAGTA
>probe:Drosophila_2:1641609_at:717:489; Interrogation_Position=2515; Antisense; GTCGACCACCAGTAACTATTACCGG
>probe:Drosophila_2:1641609_at:650:189; Interrogation_Position=2528; Antisense; AACTATTACCGGCAGCAACTGCGGC
>probe:Drosophila_2:1641609_at:507:155; Interrogation_Position=2566; Antisense; ACAGCAGGCTCTTCAGCAAGTGGCA
>probe:Drosophila_2:1641609_at:232:281; Interrogation_Position=2629; Antisense; CTCCACCACTGAACTGCTTAACGGG
>probe:Drosophila_2:1641609_at:417:281; Interrogation_Position=2701; Antisense; CTCTCTACCTCCATTTCGAGTAAAA
>probe:Drosophila_2:1641609_at:699:291; Interrogation_Position=2730; Antisense; CGTAAAGAACGCTATCCATCCTGTC
>probe:Drosophila_2:1641609_at:7:339; Interrogation_Position=2740; Antisense; GCTATCCATCCTGTCCAATGAAAAT
>probe:Drosophila_2:1641609_at:476:419; Interrogation_Position=2791; Antisense; GAGCAGCGGTTGAACTTTGACCTTT
>probe:Drosophila_2:1641609_at:227:385; Interrogation_Position=2802; Antisense; GAACTTTGACCTTTTGGCTTGCAAA
>probe:Drosophila_2:1641609_at:250:241; Interrogation_Position=2860; Antisense; AATACATTTATTTGGCTGTCGCACA
>probe:Drosophila_2:1641609_at:690:573; Interrogation_Position=2873; Antisense; GGCTGTCGCACAACCAAAATATATG
>probe:Drosophila_2:1641609_at:633:429; Interrogation_Position=2897; Antisense; GAGTATTTCTTTTTCCAGCGCTAAA

Paste this into a BLAST search page for me
CGATGAGGATGAACTCCCGCAGCATACAACGGAGGAGTCGACCACCAGTAGTCGACCACCAGTAACTATTACCGGAACTATTACCGGCAGCAACTGCGGCACAGCAGGCTCTTCAGCAAGTGGCACTCCACCACTGAACTGCTTAACGGGCTCTCTACCTCCATTTCGAGTAAAACGTAAAGAACGCTATCCATCCTGTCGCTATCCATCCTGTCCAATGAAAATGAGCAGCGGTTGAACTTTGACCTTTGAACTTTGACCTTTTGGCTTGCAAAAATACATTTATTTGGCTGTCGCACAGGCTGTCGCACAACCAAAATATATGGAGTATTTCTTTTTCCAGCGCTAAA

Full Affymetrix probeset data:

Annotations for 1641609_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime