FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641610_at:

>probe:Drosophila_2:1641610_at:527:81; Interrogation_Position=1055; Antisense; AGGTGGAGAGCTTCCCGTGCCTGTC
>probe:Drosophila_2:1641610_at:280:459; Interrogation_Position=1088; Antisense; GATTTGCCGGAATTGATGAGACCTA
>probe:Drosophila_2:1641610_at:200:57; Interrogation_Position=1103; Antisense; ATGAGACCTACTACTACAGCTGCGT
>probe:Drosophila_2:1641610_at:635:81; Interrogation_Position=1139; Antisense; AGGGCGGCTTCCACAAGTTCATTGT
>probe:Drosophila_2:1641610_at:362:473; Interrogation_Position=1155; Antisense; GTTCATTGTGCGCTGCTCCAGTGGC
>probe:Drosophila_2:1641610_at:683:81; Interrogation_Position=1174; Antisense; AGTGGCCAGAGGTTCGAGCCCCTGA
>probe:Drosophila_2:1641610_at:18:717; Interrogation_Position=1186; Antisense; TTCGAGCCCCTGATTGGAGGATGCT
>probe:Drosophila_2:1641610_at:400:445; Interrogation_Position=1205; Antisense; GATGCTGGCGCTATGACTGGACGCA
>probe:Drosophila_2:1641610_at:311:143; Interrogation_Position=1220; Antisense; ACTGGACGCAGATTGTGCCCGGACA
>probe:Drosophila_2:1641610_at:54:565; Interrogation_Position=1248; Antisense; GGCAACCGAAATCAGCGACCTGGCT
>probe:Drosophila_2:1641610_at:607:431; Interrogation_Position=1462; Antisense; GAGTCCATCGAGAGCGCTGAGTCCG
>probe:Drosophila_2:1641610_at:570:431; Interrogation_Position=1480; Antisense; GAGTCCGCGGAGTAACTTGCTCCAA
>probe:Drosophila_2:1641610_at:292:455; Interrogation_Position=1533; Antisense; GATAAACCCTTCCATTTATGTTGGT
>probe:Drosophila_2:1641610_at:655:535; Interrogation_Position=1555; Antisense; GGTCCCTTGCTCTAGTCTAGCGAAA

Paste this into a BLAST search page for me
AGGTGGAGAGCTTCCCGTGCCTGTCGATTTGCCGGAATTGATGAGACCTAATGAGACCTACTACTACAGCTGCGTAGGGCGGCTTCCACAAGTTCATTGTGTTCATTGTGCGCTGCTCCAGTGGCAGTGGCCAGAGGTTCGAGCCCCTGATTCGAGCCCCTGATTGGAGGATGCTGATGCTGGCGCTATGACTGGACGCAACTGGACGCAGATTGTGCCCGGACAGGCAACCGAAATCAGCGACCTGGCTGAGTCCATCGAGAGCGCTGAGTCCGGAGTCCGCGGAGTAACTTGCTCCAAGATAAACCCTTCCATTTATGTTGGTGGTCCCTTGCTCTAGTCTAGCGAAA

Full Affymetrix probeset data:

Annotations for 1641610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720