Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641614_at:

>probe:Drosophila_2:1641614_at:541:163; Interrogation_Position=100; Antisense; AAATAATGGCTGCTGCACCCAAGGA
>probe:Drosophila_2:1641614_at:467:5; Interrogation_Position=126; Antisense; ATTGAGAAGCCCCATGTCGGCGATT
>probe:Drosophila_2:1641614_at:85:589; Interrogation_Position=205; Antisense; TGGAGAATGTGTGCCGCGACCTGAT
>probe:Drosophila_2:1641614_at:674:171; Interrogation_Position=239; Antisense; AAAGAACCAGAACTTGCGCGTCAAG
>probe:Drosophila_2:1641614_at:339:95; Interrogation_Position=310; Antisense; AGACTCCTTGTGGTGAGGGTTCCAA
>probe:Drosophila_2:1641614_at:361:75; Interrogation_Position=325; Antisense; AGGGTTCCAAGACCTGGGATCGCTT
>probe:Drosophila_2:1641614_at:249:451; Interrogation_Position=342; Antisense; GATCGCTTCCAGATGAGAATCCACA
>probe:Drosophila_2:1641614_at:673:161; Interrogation_Position=36; Antisense; AAATTGACTGGTTCAGCGCTGCTCA
>probe:Drosophila_2:1641614_at:592:633; Interrogation_Position=387; Antisense; TCGCCCTCTGAGATCGTCAAGAAGA
>probe:Drosophila_2:1641614_at:436:215; Interrogation_Position=408; Antisense; AAGATTACCTCCATCAACATCGAGC
>probe:Drosophila_2:1641614_at:28:609; Interrogation_Position=446; Antisense; TGAGGTCACCATCGCCAACTAAGAT
>probe:Drosophila_2:1641614_at:328:97; Interrogation_Position=475; Antisense; AGATGCCACATTTTTACACCTCGAA
>probe:Drosophila_2:1641614_at:439:151; Interrogation_Position=541; Antisense; ACATTTGGCCAACTTTATTGTGCGA
>probe:Drosophila_2:1641614_at:687:459; Interrogation_Position=70; Antisense; GATTTGAATATCTCGACCAGGGAAA

Paste this into a BLAST search page for me
AAATAATGGCTGCTGCACCCAAGGAATTGAGAAGCCCCATGTCGGCGATTTGGAGAATGTGTGCCGCGACCTGATAAAGAACCAGAACTTGCGCGTCAAGAGACTCCTTGTGGTGAGGGTTCCAAAGGGTTCCAAGACCTGGGATCGCTTGATCGCTTCCAGATGAGAATCCACAAAATTGACTGGTTCAGCGCTGCTCATCGCCCTCTGAGATCGTCAAGAAGAAAGATTACCTCCATCAACATCGAGCTGAGGTCACCATCGCCAACTAAGATAGATGCCACATTTTTACACCTCGAAACATTTGGCCAACTTTATTGTGCGAGATTTGAATATCTCGACCAGGGAAA

Full Affymetrix probeset data:

Annotations for 1641614_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime