FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641615_at:

>probe:Drosophila_2:1641615_at:71:219; Interrogation_Position=2083; Antisense; AAGTGCTCCGGTGGTTTCCAGCAGA
>probe:Drosophila_2:1641615_at:629:159; Interrogation_Position=2107; Antisense; ACAACCACATGGCTTTCAGCAGGCA
>probe:Drosophila_2:1641615_at:97:615; Interrogation_Position=2142; Antisense; TGAAGAGCCAACAGCAATCCGTCTA
>probe:Drosophila_2:1641615_at:2:123; Interrogation_Position=2199; Antisense; AGCGGGAATCAGACCTCAGCGACGA
>probe:Drosophila_2:1641615_at:583:293; Interrogation_Position=2221; Antisense; CGAGGATGAGCTCTTCAAGACCGCT
>probe:Drosophila_2:1641615_at:272:213; Interrogation_Position=2237; Antisense; AAGACCGCTCAGTCACTGAACTTTG
>probe:Drosophila_2:1641615_at:422:553; Interrogation_Position=2261; Antisense; GGAGCGGCCAGCATTAACAAATTGA
>probe:Drosophila_2:1641615_at:330:375; Interrogation_Position=2308; Antisense; GAAGACCTCACAGCAGTACAACTCG
>probe:Drosophila_2:1641615_at:185:89; Interrogation_Position=2334; Antisense; AGTACAGTCCGCAGCTGGCATCTAG
>probe:Drosophila_2:1641615_at:359:697; Interrogation_Position=2474; Antisense; TTTACAACAAGTGCACCACCCGTGG
>probe:Drosophila_2:1641615_at:86:225; Interrogation_Position=2549; Antisense; AAGGACCGTCCAGCTGGCAAGAGGC
>probe:Drosophila_2:1641615_at:355:97; Interrogation_Position=2568; Antisense; AGAGGCCACCGCATGCAGACGAGGA
>probe:Drosophila_2:1641615_at:129:351; Interrogation_Position=2582; Antisense; GCAGACGAGGACACCAGCTACGATT
>probe:Drosophila_2:1641615_at:155:671; Interrogation_Position=2600; Antisense; TACGATTACGCCTACTACGACACGG

Paste this into a BLAST search page for me
AAGTGCTCCGGTGGTTTCCAGCAGAACAACCACATGGCTTTCAGCAGGCATGAAGAGCCAACAGCAATCCGTCTAAGCGGGAATCAGACCTCAGCGACGACGAGGATGAGCTCTTCAAGACCGCTAAGACCGCTCAGTCACTGAACTTTGGGAGCGGCCAGCATTAACAAATTGAGAAGACCTCACAGCAGTACAACTCGAGTACAGTCCGCAGCTGGCATCTAGTTTACAACAAGTGCACCACCCGTGGAAGGACCGTCCAGCTGGCAAGAGGCAGAGGCCACCGCATGCAGACGAGGAGCAGACGAGGACACCAGCTACGATTTACGATTACGCCTACTACGACACGG

Full Affymetrix probeset data:

Annotations for 1641615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720