FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641616_at:

>probe:Drosophila_2:1641616_at:294:5; Interrogation_Position=313; Antisense; ATTGTGGCCTACTCGCTGAACTATC
>probe:Drosophila_2:1641616_at:625:251; Interrogation_Position=354; Antisense; CAAGGATGCTCTGGTGTTCGAGGCC
>probe:Drosophila_2:1641616_at:441:69; Interrogation_Position=374; Antisense; AGGCCGCCTCAGAGTTCCGTAATTA
>probe:Drosophila_2:1641616_at:728:493; Interrogation_Position=392; Antisense; GTAATTACTGCTACAGCTACCGCGA
>probe:Drosophila_2:1641616_at:463:267; Interrogation_Position=469; Antisense; CAGGTGTACAGCATCCCGTTGGGCG
>probe:Drosophila_2:1641616_at:20:355; Interrogation_Position=515; Antisense; GCACCATCGGCGGATCGGGATCTAG
>probe:Drosophila_2:1641616_at:103:543; Interrogation_Position=550; Antisense; GGATTTGTTAGGGAGCACTACCGCC
>probe:Drosophila_2:1641616_at:477:547; Interrogation_Position=588; Antisense; GGAGGATTGCGTTACATTCGTCAAG
>probe:Drosophila_2:1641616_at:319:11; Interrogation_Position=603; Antisense; ATTCGTCAAGAAGGCTGTCCAGCAC
>probe:Drosophila_2:1641616_at:365:535; Interrogation_Position=660; Antisense; GGTGCGCATTGGCATCATCACCAAG
>probe:Drosophila_2:1641616_at:430:77; Interrogation_Position=683; Antisense; AGGATGGCATCGAGCGACGCATCTT
>probe:Drosophila_2:1641616_at:694:109; Interrogation_Position=717; Antisense; AGAATCGGGCGCATCGGCTGTTTCC
>probe:Drosophila_2:1641616_at:54:635; Interrogation_Position=747; Antisense; TCCCAGCTTCATTTCCTCGGAATAA
>probe:Drosophila_2:1641616_at:250:429; Interrogation_Position=808; Antisense; GAGTTGCAAACTCGTCTCATGCTAA

Paste this into a BLAST search page for me
ATTGTGGCCTACTCGCTGAACTATCCAAGGATGCTCTGGTGTTCGAGGCCAGGCCGCCTCAGAGTTCCGTAATTAGTAATTACTGCTACAGCTACCGCGACAGGTGTACAGCATCCCGTTGGGCGGCACCATCGGCGGATCGGGATCTAGGGATTTGTTAGGGAGCACTACCGCCGGAGGATTGCGTTACATTCGTCAAGATTCGTCAAGAAGGCTGTCCAGCACGGTGCGCATTGGCATCATCACCAAGAGGATGGCATCGAGCGACGCATCTTAGAATCGGGCGCATCGGCTGTTTCCTCCCAGCTTCATTTCCTCGGAATAAGAGTTGCAAACTCGTCTCATGCTAA

Full Affymetrix probeset data:

Annotations for 1641616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720