Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641618_at:

>probe:Drosophila_2:1641618_at:357:79; Interrogation_Position=1790; Antisense; AGGTTGCCTGGATGGCCCTGAAGAT
>probe:Drosophila_2:1641618_at:257:615; Interrogation_Position=1808; Antisense; TGAAGATGATCGACGCCTGCTCGAA
>probe:Drosophila_2:1641618_at:674:661; Interrogation_Position=1860; Antisense; TAAAATGAGGATCGGCCTGCACACG
>probe:Drosophila_2:1641618_at:169:563; Interrogation_Position=1913; Antisense; GGAAGATGCCCAGGTATTGCCTCTT
>probe:Drosophila_2:1641618_at:643:495; Interrogation_Position=1948; Antisense; GTCACCATCGCCAACAAGTTCGAGT
>probe:Drosophila_2:1641618_at:654:655; Interrogation_Position=1995; Antisense; TAATGTTAGCCCAACCACCAAGGAT
>probe:Drosophila_2:1641618_at:428:727; Interrogation_Position=2019; Antisense; TTGGCTGACCAAGCACGAGGGCTTT
>probe:Drosophila_2:1641618_at:534:341; Interrogation_Position=2039; Antisense; GCTTTGAGTTTGAGCTGCAGCCGCG
>probe:Drosophila_2:1641618_at:70:103; Interrogation_Position=2111; Antisense; AGACCTGCTACTTCCTGGAGAGCTT
>probe:Drosophila_2:1641618_at:592:199; Interrogation_Position=2140; Antisense; AACCCGGCTTTGGACAGCGAGCTGC
>probe:Drosophila_2:1641618_at:478:53; Interrogation_Position=2191; Antisense; ATGAAGACCATATCCGAGGGCGGCG
>probe:Drosophila_2:1641618_at:637:485; Interrogation_Position=2268; Antisense; GTAGTCCTAGTTCGGTGCACTTGTA
>probe:Drosophila_2:1641618_at:368:721; Interrogation_Position=2288; Antisense; TTGTATTGTGGTTTTGCCTGTTGCC
>probe:Drosophila_2:1641618_at:323:469; Interrogation_Position=2307; Antisense; GTTGCCTGCTTAGCCTAGAATCAAT

Paste this into a BLAST search page for me
AGGTTGCCTGGATGGCCCTGAAGATTGAAGATGATCGACGCCTGCTCGAATAAAATGAGGATCGGCCTGCACACGGGAAGATGCCCAGGTATTGCCTCTTGTCACCATCGCCAACAAGTTCGAGTTAATGTTAGCCCAACCACCAAGGATTTGGCTGACCAAGCACGAGGGCTTTGCTTTGAGTTTGAGCTGCAGCCGCGAGACCTGCTACTTCCTGGAGAGCTTAACCCGGCTTTGGACAGCGAGCTGCATGAAGACCATATCCGAGGGCGGCGGTAGTCCTAGTTCGGTGCACTTGTATTGTATTGTGGTTTTGCCTGTTGCCGTTGCCTGCTTAGCCTAGAATCAAT

Full Affymetrix probeset data:

Annotations for 1641618_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime