Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641619_at:

>probe:Drosophila_2:1641619_at:544:421; Interrogation_Position=1495; Antisense; GAGAATCTGCGCCTGTTTCTATACC
>probe:Drosophila_2:1641619_at:93:665; Interrogation_Position=1510; Antisense; TTTCTATACCCTTACGATCCGGAAT
>probe:Drosophila_2:1641619_at:527:447; Interrogation_Position=1525; Antisense; GATCCGGAATCGTCTGTGTACTTTG
>probe:Drosophila_2:1641619_at:44:597; Interrogation_Position=1539; Antisense; TGTGTACTTTGGCTGTCGCTTCAAA
>probe:Drosophila_2:1641619_at:496:291; Interrogation_Position=1555; Antisense; CGCTTCAAAGCGTATTTTTCCCAGG
>probe:Drosophila_2:1641619_at:462:501; Interrogation_Position=1628; Antisense; GTCGTCTGAATCTGTTCGCCCTGAA
>probe:Drosophila_2:1641619_at:643:155; Interrogation_Position=1652; Antisense; ACAGCACCACCATCTGCAAGTTGAA
>probe:Drosophila_2:1641619_at:579:97; Interrogation_Position=1697; Antisense; AGATCGGTCACTGCCTGCAAGATGT
>probe:Drosophila_2:1641619_at:721:479; Interrogation_Position=1792; Antisense; GTATTCCCAACCATCCTAAGTAATT
>probe:Drosophila_2:1641619_at:94:171; Interrogation_Position=1853; Antisense; AAAGTGATTGCTGTGCTGCTTCGGC
>probe:Drosophila_2:1641619_at:503:343; Interrogation_Position=1870; Antisense; GCTTCGGCTATATCCTTTCATTATG
>probe:Drosophila_2:1641619_at:668:691; Interrogation_Position=1917; Antisense; TTTCGAGTTCTTCCTGTACTACATG
>probe:Drosophila_2:1641619_at:317:645; Interrogation_Position=1946; Antisense; TCTTTGGATTGCACAGGACGCCGAG
>probe:Drosophila_2:1641619_at:430:299; Interrogation_Position=1982; Antisense; CGCGCTTGGGATTCCGTCAGATGAA

Paste this into a BLAST search page for me
GAGAATCTGCGCCTGTTTCTATACCTTTCTATACCCTTACGATCCGGAATGATCCGGAATCGTCTGTGTACTTTGTGTGTACTTTGGCTGTCGCTTCAAACGCTTCAAAGCGTATTTTTCCCAGGGTCGTCTGAATCTGTTCGCCCTGAAACAGCACCACCATCTGCAAGTTGAAAGATCGGTCACTGCCTGCAAGATGTGTATTCCCAACCATCCTAAGTAATTAAAGTGATTGCTGTGCTGCTTCGGCGCTTCGGCTATATCCTTTCATTATGTTTCGAGTTCTTCCTGTACTACATGTCTTTGGATTGCACAGGACGCCGAGCGCGCTTGGGATTCCGTCAGATGAA

Full Affymetrix probeset data:

Annotations for 1641619_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime