Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641621_at:

>probe:Drosophila_2:1641621_at:607:463; Interrogation_Position=1004; Antisense; GATTCCAGCAAATCCCAGGGCGATC
>probe:Drosophila_2:1641621_at:278:47; Interrogation_Position=1026; Antisense; ATCCTCTGCGATCGATTTACATACA
>probe:Drosophila_2:1641621_at:329:123; Interrogation_Position=1140; Antisense; AGCGAGCAGCGCAAACCAAACGATT
>probe:Drosophila_2:1641621_at:540:655; Interrogation_Position=1235; Antisense; TAATCTGCCGACTTTAGTTGCGAAA
>probe:Drosophila_2:1641621_at:641:557; Interrogation_Position=1348; Antisense; GGAAACTATTTTATATCGACCCAAT
>probe:Drosophila_2:1641621_at:506:103; Interrogation_Position=808; Antisense; AGACCCAACTGCAATGGATGTCCGA
>probe:Drosophila_2:1641621_at:55:549; Interrogation_Position=823; Antisense; GGATGTCCGAGCATCTGAGCTATCC
>probe:Drosophila_2:1641621_at:399:607; Interrogation_Position=838; Antisense; TGAGCTATCCCGACAACTTTTTGCA
>probe:Drosophila_2:1641621_at:32:149; Interrogation_Position=853; Antisense; ACTTTTTGCATTTATCGGTGGACTA
>probe:Drosophila_2:1641621_at:407:443; Interrogation_Position=882; Antisense; GATGTTTAGCCTTATCCCTATATGT
>probe:Drosophila_2:1641621_at:28:689; Interrogation_Position=906; Antisense; TATATAGCCCTATGTTTTGCCCAGT
>probe:Drosophila_2:1641621_at:511:471; Interrogation_Position=929; Antisense; GTTCGCGTGCGTGTATATTTATGTT
>probe:Drosophila_2:1641621_at:53:691; Interrogation_Position=952; Antisense; TTTGTGTTCGTGTCAATGTGTGCTT
>probe:Drosophila_2:1641621_at:94:351; Interrogation_Position=989; Antisense; GCAGTTCTATTTTTCGATTCCAGCA

Paste this into a BLAST search page for me
GATTCCAGCAAATCCCAGGGCGATCATCCTCTGCGATCGATTTACATACAAGCGAGCAGCGCAAACCAAACGATTTAATCTGCCGACTTTAGTTGCGAAAGGAAACTATTTTATATCGACCCAATAGACCCAACTGCAATGGATGTCCGAGGATGTCCGAGCATCTGAGCTATCCTGAGCTATCCCGACAACTTTTTGCAACTTTTTGCATTTATCGGTGGACTAGATGTTTAGCCTTATCCCTATATGTTATATAGCCCTATGTTTTGCCCAGTGTTCGCGTGCGTGTATATTTATGTTTTTGTGTTCGTGTCAATGTGTGCTTGCAGTTCTATTTTTCGATTCCAGCA

Full Affymetrix probeset data:

Annotations for 1641621_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime