FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641622_at:

>probe:Drosophila_2:1641622_at:17:191; Interrogation_Position=106; Antisense; AACTTTCAGTGGTCCTTCGAGACCA
>probe:Drosophila_2:1641622_at:310:503; Interrogation_Position=117; Antisense; GTCCTTCGAGACCAGCGATGGCCAG
>probe:Drosophila_2:1641622_at:180:331; Interrogation_Position=142; Antisense; GCGGCTAACGCTAAGGGACAGTTGA
>probe:Drosophila_2:1641622_at:143:397; Interrogation_Position=15; Antisense; GAAATTCCTGATCGTCTTTGTAGCA
>probe:Drosophila_2:1641622_at:570:367; Interrogation_Position=158; Antisense; GACAGTTGAAGTACCCTAACACCGA
>probe:Drosophila_2:1641622_at:135:261; Interrogation_Position=184; Antisense; CACGAGTCCCTTGCTGTCCAGGGAT
>probe:Drosophila_2:1641622_at:408:597; Interrogation_Position=198; Antisense; TGTCCAGGGATCCTTCCGCTTCGTT
>probe:Drosophila_2:1641622_at:568:713; Interrogation_Position=211; Antisense; TTCCGCTTCGTTGCCGATGATGGCC
>probe:Drosophila_2:1641622_at:459:451; Interrogation_Position=24; Antisense; GATCGTCTTTGTAGCAATCTTCGCT
>probe:Drosophila_2:1641622_at:307:239; Interrogation_Position=39; Antisense; AATCTTCGCTTTTGCTTTGGCTAAC
>probe:Drosophila_2:1641622_at:500:719; Interrogation_Position=50; Antisense; TTGCTTTGGCTAACGAAGCGCAAAT
>probe:Drosophila_2:1641622_at:135:325; Interrogation_Position=67; Antisense; GCGCAAATTATTAACTTGGAATCCG
>probe:Drosophila_2:1641622_at:304:149; Interrogation_Position=80; Antisense; ACTTGGAATCCGATGTTGGACCCGA
>probe:Drosophila_2:1641622_at:470:437; Interrogation_Position=91; Antisense; GATGTTGGACCCGAAAACTTTCAGT

Paste this into a BLAST search page for me
AACTTTCAGTGGTCCTTCGAGACCAGTCCTTCGAGACCAGCGATGGCCAGGCGGCTAACGCTAAGGGACAGTTGAGAAATTCCTGATCGTCTTTGTAGCAGACAGTTGAAGTACCCTAACACCGACACGAGTCCCTTGCTGTCCAGGGATTGTCCAGGGATCCTTCCGCTTCGTTTTCCGCTTCGTTGCCGATGATGGCCGATCGTCTTTGTAGCAATCTTCGCTAATCTTCGCTTTTGCTTTGGCTAACTTGCTTTGGCTAACGAAGCGCAAATGCGCAAATTATTAACTTGGAATCCGACTTGGAATCCGATGTTGGACCCGAGATGTTGGACCCGAAAACTTTCAGT

Full Affymetrix probeset data:

Annotations for 1641622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720