FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641623_at:

>probe:Drosophila_2:1641623_at:413:443; Interrogation_Position=121; Antisense; GATGACGACGATACCAGCTCGAGAT
>probe:Drosophila_2:1641623_at:35:429; Interrogation_Position=141; Antisense; GAGATTCACATACTCGACCACAACG
>probe:Drosophila_2:1641623_at:662:157; Interrogation_Position=160; Antisense; ACAACGACAACTGAGGAACCCGCAT
>probe:Drosophila_2:1641623_at:630:345; Interrogation_Position=181; Antisense; GCATCCACAATAGCACTCCGTTTGG
>probe:Drosophila_2:1641623_at:452:111; Interrogation_Position=217; Antisense; AGCACAGAACAGATCACCAGCGGAT
>probe:Drosophila_2:1641623_at:290:613; Interrogation_Position=258; Antisense; TGAAAACACCACTGTGCTGCCAGTT
>probe:Drosophila_2:1641623_at:640:507; Interrogation_Position=271; Antisense; GTGCTGCCAGTTATAGACAACCGAA
>probe:Drosophila_2:1641623_at:349:235; Interrogation_Position=28; Antisense; AATCCATTGGTGCTGTGCATCCTAC
>probe:Drosophila_2:1641623_at:618:201; Interrogation_Position=289; Antisense; AACCGAATATTGCTGGAGACGACCC
>probe:Drosophila_2:1641623_at:677:409; Interrogation_Position=309; Antisense; GACCCAAAAATGTAAGCCTGGCTTT
>probe:Drosophila_2:1641623_at:521:123; Interrogation_Position=323; Antisense; AGCCTGGCTTTGAGCTGTTCGGAAA
>probe:Drosophila_2:1641623_at:141:183; Interrogation_Position=345; Antisense; AAAACGATGCAGAAAGCCGGCGTAA
>probe:Drosophila_2:1641623_at:716:383; Interrogation_Position=80; Antisense; GAACACGGCCCAGTGGTAACGATCG
>probe:Drosophila_2:1641623_at:320:293; Interrogation_Position=99; Antisense; CGATCGCATCGTTTTTCCAAAGGAT

Paste this into a BLAST search page for me
GATGACGACGATACCAGCTCGAGATGAGATTCACATACTCGACCACAACGACAACGACAACTGAGGAACCCGCATGCATCCACAATAGCACTCCGTTTGGAGCACAGAACAGATCACCAGCGGATTGAAAACACCACTGTGCTGCCAGTTGTGCTGCCAGTTATAGACAACCGAAAATCCATTGGTGCTGTGCATCCTACAACCGAATATTGCTGGAGACGACCCGACCCAAAAATGTAAGCCTGGCTTTAGCCTGGCTTTGAGCTGTTCGGAAAAAAACGATGCAGAAAGCCGGCGTAAGAACACGGCCCAGTGGTAACGATCGCGATCGCATCGTTTTTCCAAAGGAT

Full Affymetrix probeset data:

Annotations for 1641623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720