FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641624_at:

>probe:Drosophila_2:1641624_at:285:193; Interrogation_Position=147; Antisense; AACTCAGCAGATTGCGCGGGTCATC
>probe:Drosophila_2:1641624_at:521:419; Interrogation_Position=202; Antisense; GAGACCGTGGACGAAACGTTCCTTG
>probe:Drosophila_2:1641624_at:475:447; Interrogation_Position=231; Antisense; GATGCCCAACAAATTCCGCAAGAGC
>probe:Drosophila_2:1641624_at:131:391; Interrogation_Position=264; Antisense; GAAACGTGGCGACTTTCTGCTGGTC
>probe:Drosophila_2:1641624_at:692:691; Interrogation_Position=277; Antisense; TTTCTGCTGGTCGAACCGATTGAGG
>probe:Drosophila_2:1641624_at:175:667; Interrogation_Position=327; Antisense; TTGCAAAATACTCACACCCGAACAT
>probe:Drosophila_2:1641624_at:429:183; Interrogation_Position=366; Antisense; AAAAGCTGCAATTTGGCCGGATAAA
>probe:Drosophila_2:1641624_at:304:489; Interrogation_Position=406; Antisense; GTACAGGAGGAAGCCACCAGCCAAA
>probe:Drosophila_2:1641624_at:185:213; Interrogation_Position=434; Antisense; AAGACGACTCCGATTTCGAGGATGA
>probe:Drosophila_2:1641624_at:566:547; Interrogation_Position=453; Antisense; GGATGATCTCCTGCCCAATACAAAT
>probe:Drosophila_2:1641624_at:720:27; Interrogation_Position=470; Antisense; ATACAAATCGGCCTGTAAATCGCGA
>probe:Drosophila_2:1641624_at:564:163; Interrogation_Position=486; Antisense; AAATCGCGATTCCTCCGACGAAGAG
>probe:Drosophila_2:1641624_at:690:453; Interrogation_Position=71; Antisense; GATCACACCCGAGTATCAGTCGTCG
>probe:Drosophila_2:1641624_at:372:647; Interrogation_Position=86; Antisense; TCAGTCGTCGCAAGCATCTCATGAA

Paste this into a BLAST search page for me
AACTCAGCAGATTGCGCGGGTCATCGAGACCGTGGACGAAACGTTCCTTGGATGCCCAACAAATTCCGCAAGAGCGAAACGTGGCGACTTTCTGCTGGTCTTTCTGCTGGTCGAACCGATTGAGGTTGCAAAATACTCACACCCGAACATAAAAGCTGCAATTTGGCCGGATAAAGTACAGGAGGAAGCCACCAGCCAAAAAGACGACTCCGATTTCGAGGATGAGGATGATCTCCTGCCCAATACAAATATACAAATCGGCCTGTAAATCGCGAAAATCGCGATTCCTCCGACGAAGAGGATCACACCCGAGTATCAGTCGTCGTCAGTCGTCGCAAGCATCTCATGAA

Full Affymetrix probeset data:

Annotations for 1641624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720