FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641626_at:

>probe:Drosophila_2:1641626_at:404:519; Interrogation_Position=1062; Antisense; GTGGACTAGCTTGGGAGATCCTAAG
>probe:Drosophila_2:1641626_at:329:447; Interrogation_Position=1078; Antisense; GATCCTAAGGAGATTGTTTCCCGCG
>probe:Drosophila_2:1641626_at:412:5; Interrogation_Position=1090; Antisense; ATTGTTTCCCGCGTCTATTGGATAA
>probe:Drosophila_2:1641626_at:243:121; Interrogation_Position=1136; Antisense; AGCGAATTAATCAACGCATTTCCGA
>probe:Drosophila_2:1641626_at:121:345; Interrogation_Position=1151; Antisense; GCATTTCCGACATGACGGGCTTCAA
>probe:Drosophila_2:1641626_at:239:377; Interrogation_Position=1180; Antisense; GAAGAATTTCCAGCCATACAATTGG
>probe:Drosophila_2:1641626_at:73:539; Interrogation_Position=1223; Antisense; GGTACTTCAAGCCACATTACGACTT
>probe:Drosophila_2:1641626_at:464:187; Interrogation_Position=1282; Antisense; AACACGCTGGGAGATCGAATTGGCA
>probe:Drosophila_2:1641626_at:147:499; Interrogation_Position=1330; Antisense; GTCTCACAGGGTGGACAAACCGTAT
>probe:Drosophila_2:1641626_at:15:541; Interrogation_Position=1406; Antisense; GGTTCAATGCTTTCGATGATTCAAC
>probe:Drosophila_2:1641626_at:319:59; Interrogation_Position=1421; Antisense; ATGATTCAACGCCAGATCCACGATC
>probe:Drosophila_2:1641626_at:367:517; Interrogation_Position=1456; Antisense; GTGTGTCCAGTTTTAGTGGGTTCAC
>probe:Drosophila_2:1641626_at:305:309; Interrogation_Position=1575; Antisense; CCAATTGTTTGTGAAGCCCTGCAGC
>probe:Drosophila_2:1641626_at:301:321; Interrogation_Position=1590; Antisense; GCCCTGCAGCCCAAGAGTTCATTTG

Paste this into a BLAST search page for me
GTGGACTAGCTTGGGAGATCCTAAGGATCCTAAGGAGATTGTTTCCCGCGATTGTTTCCCGCGTCTATTGGATAAAGCGAATTAATCAACGCATTTCCGAGCATTTCCGACATGACGGGCTTCAAGAAGAATTTCCAGCCATACAATTGGGGTACTTCAAGCCACATTACGACTTAACACGCTGGGAGATCGAATTGGCAGTCTCACAGGGTGGACAAACCGTATGGTTCAATGCTTTCGATGATTCAACATGATTCAACGCCAGATCCACGATCGTGTGTCCAGTTTTAGTGGGTTCACCCAATTGTTTGTGAAGCCCTGCAGCGCCCTGCAGCCCAAGAGTTCATTTG

Full Affymetrix probeset data:

Annotations for 1641626_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720