FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641627_at:

>probe:Drosophila_2:1641627_at:479:89; Interrogation_Position=155; Antisense; AGTAGCGTTCCGGAATGTCTGCCAC
>probe:Drosophila_2:1641627_at:241:393; Interrogation_Position=221; Antisense; GAAAGGGTCTTCACTCCAGGGCATA
>probe:Drosophila_2:1641627_at:342:67; Interrogation_Position=248; Antisense; ATGGACTTATCAAGGCCTGCGACAA
>probe:Drosophila_2:1641627_at:21:215; Interrogation_Position=286; Antisense; AAGATGCGACCCTTGTGGATGCACC
>probe:Drosophila_2:1641627_at:5:415; Interrogation_Position=324; Antisense; GACCATATTCTTTTGGGCTCCAATC
>probe:Drosophila_2:1641627_at:309:249; Interrogation_Position=344; Antisense; CAATCGTTAAGTGGAGCCTCGTTAT
>probe:Drosophila_2:1641627_at:645:475; Interrogation_Position=364; Antisense; GTTATCGCGGGTCTCAGTGATTTGA
>probe:Drosophila_2:1641627_at:518:513; Interrogation_Position=380; Antisense; GTGATTTGACGCGTCCTGCGGACAA
>probe:Drosophila_2:1641627_at:377:215; Interrogation_Position=403; Antisense; AAGATTTCGCCTAACGGATGTCTGG
>probe:Drosophila_2:1641627_at:352:411; Interrogation_Position=453; Antisense; GACGCGCTACTCTCTGGTGATCATT
>probe:Drosophila_2:1641627_at:327:279; Interrogation_Position=486; Antisense; CTACAGCTTGTTCGCGGTTAATCTC
>probe:Drosophila_2:1641627_at:126:655; Interrogation_Position=504; Antisense; TAATCTCTTCGTGAGTCTGACGCAG
>probe:Drosophila_2:1641627_at:431:609; Interrogation_Position=521; Antisense; TGACGCAGCTCTTCCAATTGGGTAG
>probe:Drosophila_2:1641627_at:410:169; Interrogation_Position=585; Antisense; AAATGGCGAGCAATGCCCGGCTATT

Paste this into a BLAST search page for me
AGTAGCGTTCCGGAATGTCTGCCACGAAAGGGTCTTCACTCCAGGGCATAATGGACTTATCAAGGCCTGCGACAAAAGATGCGACCCTTGTGGATGCACCGACCATATTCTTTTGGGCTCCAATCCAATCGTTAAGTGGAGCCTCGTTATGTTATCGCGGGTCTCAGTGATTTGAGTGATTTGACGCGTCCTGCGGACAAAAGATTTCGCCTAACGGATGTCTGGGACGCGCTACTCTCTGGTGATCATTCTACAGCTTGTTCGCGGTTAATCTCTAATCTCTTCGTGAGTCTGACGCAGTGACGCAGCTCTTCCAATTGGGTAGAAATGGCGAGCAATGCCCGGCTATT

Full Affymetrix probeset data:

Annotations for 1641627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720