FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641629_at:

>probe:Drosophila_2:1641629_at:346:79; Interrogation_Position=1172; Antisense; AGGTTTTCGGTTACTCATCGTACAT
>probe:Drosophila_2:1641629_at:642:135; Interrogation_Position=1270; Antisense; ACTAACGAAGACGATCCCCTGGGTG
>probe:Drosophila_2:1641629_at:178:47; Interrogation_Position=1283; Antisense; ATCCCCTGGGTGAGAGCTACGAACA
>probe:Drosophila_2:1641629_at:462:387; Interrogation_Position=1303; Antisense; GAACAACATGTCTTGGCATCGGATG
>probe:Drosophila_2:1641629_at:524:343; Interrogation_Position=1318; Antisense; GCATCGGATGTTCAAAGCCTACTAG
>probe:Drosophila_2:1641629_at:336:229; Interrogation_Position=1445; Antisense; AATGTGAACCACTGAAGGCTCCCTG
>probe:Drosophila_2:1641629_at:29:307; Interrogation_Position=1466; Antisense; CCTGCTTTTTCGATCTGGCCAAAGA
>probe:Drosophila_2:1641629_at:107:581; Interrogation_Position=1482; Antisense; GGCCAAAGATCCCTGCGAGCGATAC
>probe:Drosophila_2:1641629_at:308:417; Interrogation_Position=1498; Antisense; GAGCGATACAACCTAGCCCAAATGT
>probe:Drosophila_2:1641629_at:78:169; Interrogation_Position=1517; Antisense; AAATGTATCCACTCCAACTGCAGCA
>probe:Drosophila_2:1641629_at:578:9; Interrogation_Position=1564; Antisense; ATTCGGAAGACTGCGATTCCCAGCG
>probe:Drosophila_2:1641629_at:53:305; Interrogation_Position=1590; Antisense; CCGAGTTCCGCATTCTGATTCAAGA
>probe:Drosophila_2:1641629_at:505:461; Interrogation_Position=1606; Antisense; GATTCAAGAGCTAACCCGACTTTCC
>probe:Drosophila_2:1641629_at:173:541; Interrogation_Position=1662; Antisense; GGATACGCAATCAGGTTCCGGCACC

Paste this into a BLAST search page for me
AGGTTTTCGGTTACTCATCGTACATACTAACGAAGACGATCCCCTGGGTGATCCCCTGGGTGAGAGCTACGAACAGAACAACATGTCTTGGCATCGGATGGCATCGGATGTTCAAAGCCTACTAGAATGTGAACCACTGAAGGCTCCCTGCCTGCTTTTTCGATCTGGCCAAAGAGGCCAAAGATCCCTGCGAGCGATACGAGCGATACAACCTAGCCCAAATGTAAATGTATCCACTCCAACTGCAGCAATTCGGAAGACTGCGATTCCCAGCGCCGAGTTCCGCATTCTGATTCAAGAGATTCAAGAGCTAACCCGACTTTCCGGATACGCAATCAGGTTCCGGCACC

Full Affymetrix probeset data:

Annotations for 1641629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720