Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641630_at:

>probe:Drosophila_2:1641630_at:691:141; Interrogation_Position=1678; Antisense; ACTGGTCCGGCTTCGAGGCGACGAA
>probe:Drosophila_2:1641630_at:584:33; Interrogation_Position=1705; Antisense; ATCAGAGTTCAGAGACCTCCTACCA
>probe:Drosophila_2:1641630_at:445:671; Interrogation_Position=1725; Antisense; TACCAGAACGCTTCGTCCGGCGGAT
>probe:Drosophila_2:1641630_at:626:545; Interrogation_Position=1746; Antisense; GGATCGACAGCTCGCCGCAACATGA
>probe:Drosophila_2:1641630_at:654:187; Interrogation_Position=1764; Antisense; AACATGAAGCTGCAGGACACATCGC
>probe:Drosophila_2:1641630_at:724:409; Interrogation_Position=1881; Antisense; GACGACGCCTGGAATCTGCTGATGA
>probe:Drosophila_2:1641630_at:694:201; Interrogation_Position=1912; Antisense; AACCGTGGCGAGCAGCTTATGCGAT
>probe:Drosophila_2:1641630_at:314:717; Interrogation_Position=1955; Antisense; TTCGGTTGTCAAGTTGTGTCTCCTT
>probe:Drosophila_2:1641630_at:660:515; Interrogation_Position=1970; Antisense; GTGTCTCCTTTGTTTTATGTGTCTC
>probe:Drosophila_2:1641630_at:655:705; Interrogation_Position=1984; Antisense; TTATGTGTCTCTTGATGTCTGGCCC
>probe:Drosophila_2:1641630_at:233:295; Interrogation_Position=2009; Antisense; CGAGGCTGCTATGCGCGCATTTAAT
>probe:Drosophila_2:1641630_at:413:515; Interrogation_Position=2049; Antisense; GTGTATTCATTCTTCGACTTCAAAC
>probe:Drosophila_2:1641630_at:72:253; Interrogation_Position=2082; Antisense; CAACTATTCCCGATTATTTCCACAG
>probe:Drosophila_2:1641630_at:1:601; Interrogation_Position=2160; Antisense; TGTATGCCAGGATACTGCGAGGGAT

Paste this into a BLAST search page for me
ACTGGTCCGGCTTCGAGGCGACGAAATCAGAGTTCAGAGACCTCCTACCATACCAGAACGCTTCGTCCGGCGGATGGATCGACAGCTCGCCGCAACATGAAACATGAAGCTGCAGGACACATCGCGACGACGCCTGGAATCTGCTGATGAAACCGTGGCGAGCAGCTTATGCGATTTCGGTTGTCAAGTTGTGTCTCCTTGTGTCTCCTTTGTTTTATGTGTCTCTTATGTGTCTCTTGATGTCTGGCCCCGAGGCTGCTATGCGCGCATTTAATGTGTATTCATTCTTCGACTTCAAACCAACTATTCCCGATTATTTCCACAGTGTATGCCAGGATACTGCGAGGGAT

Full Affymetrix probeset data:

Annotations for 1641630_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime