FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641631_at:

>probe:Drosophila_2:1641631_at:411:365; Interrogation_Position=114; Antisense; GAATATGCTCCCAGTGTCGTAGGAT
>probe:Drosophila_2:1641631_at:4:697; Interrogation_Position=13; Antisense; TTTCCCCAGCGAAGATGTTCAAAGT
>probe:Drosophila_2:1641631_at:385:457; Interrogation_Position=136; Antisense; GATACGAGAGTTATGCCCTTCCAGC
>probe:Drosophila_2:1641631_at:101:499; Interrogation_Position=165; Antisense; GTCTCACACCAGAGTTCCACAGTGG
>probe:Drosophila_2:1641631_at:466:533; Interrogation_Position=188; Antisense; GGTGCACGAGAAGCGTCCCTACTGG
>probe:Drosophila_2:1641631_at:123:671; Interrogation_Position=207; Antisense; TACTGGCGCCCCATTGTGGATCACA
>probe:Drosophila_2:1641631_at:243:225; Interrogation_Position=243; Antisense; AAGGCAGCCTATGCTCCAGCTACTT
>probe:Drosophila_2:1641631_at:92:715; Interrogation_Position=266; Antisense; TTCGATCTCGTATGCCCCACTTGGA
>probe:Drosophila_2:1641631_at:419:301; Interrogation_Position=281; Antisense; CCCACTTGGATACGCGGGCAACAGT
>probe:Drosophila_2:1641631_at:376:91; Interrogation_Position=335; Antisense; AGTATCCAGTTACCCCAGCATTTAT
>probe:Drosophila_2:1641631_at:54:91; Interrogation_Position=35; Antisense; AGTTGTGTTCCTTTTGTGCGGAGTA
>probe:Drosophila_2:1641631_at:584:151; Interrogation_Position=424; Antisense; ACATATTACCTCTTCTGTATTGCAA
>probe:Drosophila_2:1641631_at:150:549; Interrogation_Position=54; Antisense; GGAGTATTCGCTGTCCTGATCCAGG
>probe:Drosophila_2:1641631_at:48:151; Interrogation_Position=91; Antisense; ACTTGCCCAGCTATGAGCACGTGGA

Paste this into a BLAST search page for me
GAATATGCTCCCAGTGTCGTAGGATTTTCCCCAGCGAAGATGTTCAAAGTGATACGAGAGTTATGCCCTTCCAGCGTCTCACACCAGAGTTCCACAGTGGGGTGCACGAGAAGCGTCCCTACTGGTACTGGCGCCCCATTGTGGATCACAAAGGCAGCCTATGCTCCAGCTACTTTTCGATCTCGTATGCCCCACTTGGACCCACTTGGATACGCGGGCAACAGTAGTATCCAGTTACCCCAGCATTTATAGTTGTGTTCCTTTTGTGCGGAGTAACATATTACCTCTTCTGTATTGCAAGGAGTATTCGCTGTCCTGATCCAGGACTTGCCCAGCTATGAGCACGTGGA

Full Affymetrix probeset data:

Annotations for 1641631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720