FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641632_at:

>probe:Drosophila_2:1641632_at:357:545; Interrogation_Position=114; Antisense; GGATCAGCCGGATATGTGTGCCTTT
>probe:Drosophila_2:1641632_at:574:315; Interrogation_Position=133; Antisense; GCCTTTTGCCTGGATCGCATACAGA
>probe:Drosophila_2:1641632_at:508:207; Interrogation_Position=166; Antisense; AAGCTGCACTGCAATCATGCGTTCT
>probe:Drosophila_2:1641632_at:292:665; Interrogation_Position=17; Antisense; TACAGCAGGGCCTCGATGCGACGAA
>probe:Drosophila_2:1641632_at:635:51; Interrogation_Position=182; Antisense; ATGCGTTCTGCAAAAGCTGTTTAGC
>probe:Drosophila_2:1641632_at:421:355; Interrogation_Position=205; Antisense; GCACTGTACAGGGAAGCTCGCAACT
>probe:Drosophila_2:1641632_at:622:205; Interrogation_Position=238; Antisense; AAGCGTTGCCCAATCTGTCGGAGCA
>probe:Drosophila_2:1641632_at:449:153; Interrogation_Position=269; Antisense; ACATGGATGGCCAGGTGTCCAGGCA
>probe:Drosophila_2:1641632_at:179:95; Interrogation_Position=293; Antisense; AGTTCCACGATAACTGGCGTCTATT
>probe:Drosophila_2:1641632_at:425:57; Interrogation_Position=325; Antisense; ATGATGGTACCGCTGATGGTGCTCA
>probe:Drosophila_2:1641632_at:693:319; Interrogation_Position=356; Antisense; GCCCCTTTTATTTGCTGTTGCTTTA
>probe:Drosophila_2:1641632_at:425:385; Interrogation_Position=39; Antisense; GAACTTTGGTCTGCGGAGCGACTAC
>probe:Drosophila_2:1641632_at:26:417; Interrogation_Position=54; Antisense; GAGCGACTACTCCAGTGAGAACGGC
>probe:Drosophila_2:1641632_at:301:107; Interrogation_Position=71; Antisense; AGAACGGCGATCATCCATCGTTGTT

Paste this into a BLAST search page for me
GGATCAGCCGGATATGTGTGCCTTTGCCTTTTGCCTGGATCGCATACAGAAAGCTGCACTGCAATCATGCGTTCTTACAGCAGGGCCTCGATGCGACGAAATGCGTTCTGCAAAAGCTGTTTAGCGCACTGTACAGGGAAGCTCGCAACTAAGCGTTGCCCAATCTGTCGGAGCAACATGGATGGCCAGGTGTCCAGGCAAGTTCCACGATAACTGGCGTCTATTATGATGGTACCGCTGATGGTGCTCAGCCCCTTTTATTTGCTGTTGCTTTAGAACTTTGGTCTGCGGAGCGACTACGAGCGACTACTCCAGTGAGAACGGCAGAACGGCGATCATCCATCGTTGTT

Full Affymetrix probeset data:

Annotations for 1641632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720