Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641633_at:

>probe:Drosophila_2:1641633_at:399:497; Interrogation_Position=3318; Antisense; GTCTGATACAGAAGGCGTTGCTCAC
>probe:Drosophila_2:1641633_at:272:293; Interrogation_Position=3333; Antisense; CGTTGCTCACGTTTCTGAAGCTCAA
>probe:Drosophila_2:1641633_at:131:169; Interrogation_Position=3367; Antisense; AAATGGTCAGGCTCCACTCGGGAAA
>probe:Drosophila_2:1641633_at:218:267; Interrogation_Position=3451; Antisense; CAGGGATTTCCCGAGTGTCAAAACA
>probe:Drosophila_2:1641633_at:645:355; Interrogation_Position=3486; Antisense; GCACTTTCCCACTGAAGAGACAGCT
>probe:Drosophila_2:1641633_at:46:425; Interrogation_Position=3502; Antisense; GAGACAGCTGCAAAGGCATTCACAT
>probe:Drosophila_2:1641633_at:434:11; Interrogation_Position=3519; Antisense; ATTCACATGTGATCCAAGTCGTATT
>probe:Drosophila_2:1641633_at:146:443; Interrogation_Position=3589; Antisense; GATGTACCCTAGAACTTAGCCACTA
>probe:Drosophila_2:1641633_at:631:705; Interrogation_Position=3604; Antisense; TTAGCCACTAGTTGAGTTCCCACGA
>probe:Drosophila_2:1641633_at:433:429; Interrogation_Position=3617; Antisense; GAGTTCCCACGAGATCAGTGTGTGT
>probe:Drosophila_2:1641633_at:376:491; Interrogation_Position=3720; Antisense; GTAATCTCAAATCCGAGCCTAATTT
>probe:Drosophila_2:1641633_at:574:415; Interrogation_Position=3734; Antisense; GAGCCTAATTTATTCAGCCGACCAG
>probe:Drosophila_2:1641633_at:233:623; Interrogation_Position=3771; Antisense; TGCGCAGAACTAGCAACTTGCCATA
>probe:Drosophila_2:1641633_at:522:397; Interrogation_Position=3802; Antisense; GAGCACCTACCAGCATTAAGAACGA

Paste this into a BLAST search page for me
GTCTGATACAGAAGGCGTTGCTCACCGTTGCTCACGTTTCTGAAGCTCAAAAATGGTCAGGCTCCACTCGGGAAACAGGGATTTCCCGAGTGTCAAAACAGCACTTTCCCACTGAAGAGACAGCTGAGACAGCTGCAAAGGCATTCACATATTCACATGTGATCCAAGTCGTATTGATGTACCCTAGAACTTAGCCACTATTAGCCACTAGTTGAGTTCCCACGAGAGTTCCCACGAGATCAGTGTGTGTGTAATCTCAAATCCGAGCCTAATTTGAGCCTAATTTATTCAGCCGACCAGTGCGCAGAACTAGCAACTTGCCATAGAGCACCTACCAGCATTAAGAACGA

Full Affymetrix probeset data:

Annotations for 1641633_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime