FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641634_at:

>probe:Drosophila_2:1641634_at:215:611; Interrogation_Position=1736; Antisense; TGACTTCTCCTTCTGGGTGAACGAT
>probe:Drosophila_2:1641634_at:491:605; Interrogation_Position=1792; Antisense; TGATGGACGCCACCAACAGTGACTA
>probe:Drosophila_2:1641634_at:205:723; Interrogation_Position=1847; Antisense; TTGCGGCGTGCCCAACCGAATGATG
>probe:Drosophila_2:1641634_at:86:93; Interrogation_Position=1906; Antisense; AGTTCTTCTACATGGTCTACCCGTA
>probe:Drosophila_2:1641634_at:293:93; Interrogation_Position=1951; Antisense; AGTTCACTGGCTACGATCCGGTGGT
>probe:Drosophila_2:1641634_at:521:57; Interrogation_Position=2040; Antisense; AGGCCGGTGAAGCATGACTACTACT
>probe:Drosophila_2:1641634_at:347:147; Interrogation_Position=2056; Antisense; ACTACTACTTCGATGTCCACAACTT
>probe:Drosophila_2:1641634_at:127:471; Interrogation_Position=2084; Antisense; GTTCGTCGACGTGAAGATCTTCCAT
>probe:Drosophila_2:1641634_at:221:615; Interrogation_Position=2095; Antisense; TGAAGATCTTCCATCGCGACGAGCA
>probe:Drosophila_2:1641634_at:190:499; Interrogation_Position=2130; Antisense; GTCTAGATCCTGGACCCAACGAATA
>probe:Drosophila_2:1641634_at:45:477; Interrogation_Position=2206; Antisense; GTTATATCTTTGTCTGCATCCACTT
>probe:Drosophila_2:1641634_at:528:47; Interrogation_Position=2223; Antisense; ATCCACTTACCCCATAGAGATCGTA
>probe:Drosophila_2:1641634_at:180:245; Interrogation_Position=2257; Antisense; AATTTTTACCCAGCTTGTCAGTCCA
>probe:Drosophila_2:1641634_at:518:503; Interrogation_Position=2277; Antisense; GTCCACCTTGTGACCATCGAACAAT

Paste this into a BLAST search page for me
TGACTTCTCCTTCTGGGTGAACGATTGATGGACGCCACCAACAGTGACTATTGCGGCGTGCCCAACCGAATGATGAGTTCTTCTACATGGTCTACCCGTAAGTTCACTGGCTACGATCCGGTGGTAGGCCGGTGAAGCATGACTACTACTACTACTACTTCGATGTCCACAACTTGTTCGTCGACGTGAAGATCTTCCATTGAAGATCTTCCATCGCGACGAGCAGTCTAGATCCTGGACCCAACGAATAGTTATATCTTTGTCTGCATCCACTTATCCACTTACCCCATAGAGATCGTAAATTTTTACCCAGCTTGTCAGTCCAGTCCACCTTGTGACCATCGAACAAT

Full Affymetrix probeset data:

Annotations for 1641634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720