FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641637_at:

>probe:Drosophila_2:1641637_at:510:523; Interrogation_Position=1049; Antisense; GGGCCTATACCATCACGTCAGTGAA
>probe:Drosophila_2:1641637_at:492:455; Interrogation_Position=1124; Antisense; GATACTCGACGGACTTGTGTTTCAG
>probe:Drosophila_2:1641637_at:57:721; Interrogation_Position=1138; Antisense; TTGTGTTTCAGCTCGGAGACACCGT
>probe:Drosophila_2:1641637_at:35:531; Interrogation_Position=1164; Antisense; GGGATTGCTGATTGCTCCGGAGTCC
>probe:Drosophila_2:1641637_at:63:683; Interrogation_Position=1192; Antisense; TATCGGGAACCGCTTCAGCATTTCA
>probe:Drosophila_2:1641637_at:55:331; Interrogation_Position=1285; Antisense; GCGGGACGCATGACCATCAAGGATT
>probe:Drosophila_2:1641637_at:274:655; Interrogation_Position=1325; Antisense; TAATGAAACCGCTGCGCATCCAGGA
>probe:Drosophila_2:1641637_at:396:75; Interrogation_Position=1346; Antisense; AGGACCTTCGCAAGTGCTGGGTCAT
>probe:Drosophila_2:1641637_at:24:647; Interrogation_Position=1367; Antisense; TCATCTTTGCAGTGGGTCTGGGCAC
>probe:Drosophila_2:1641637_at:484:405; Interrogation_Position=1395; Antisense; GACTGTCGTATTCACCATCGAATTG
>probe:Drosophila_2:1641637_at:521:7; Interrogation_Position=1416; Antisense; ATTGCTTCTTATCTACACCAACGTG
>probe:Drosophila_2:1641637_at:92:207; Interrogation_Position=888; Antisense; AAGCTTTGATGACCTCTTAACCTCT
>probe:Drosophila_2:1641637_at:299:199; Interrogation_Position=906; Antisense; AACCTCTGGCTTAAAGATCTTCGGA
>probe:Drosophila_2:1641637_at:345:477; Interrogation_Position=962; Antisense; GTTTTCGGGCAAAGTACGCATCAGC

Paste this into a BLAST search page for me
GGGCCTATACCATCACGTCAGTGAAGATACTCGACGGACTTGTGTTTCAGTTGTGTTTCAGCTCGGAGACACCGTGGGATTGCTGATTGCTCCGGAGTCCTATCGGGAACCGCTTCAGCATTTCAGCGGGACGCATGACCATCAAGGATTTAATGAAACCGCTGCGCATCCAGGAAGGACCTTCGCAAGTGCTGGGTCATTCATCTTTGCAGTGGGTCTGGGCACGACTGTCGTATTCACCATCGAATTGATTGCTTCTTATCTACACCAACGTGAAGCTTTGATGACCTCTTAACCTCTAACCTCTGGCTTAAAGATCTTCGGAGTTTTCGGGCAAAGTACGCATCAGC

Full Affymetrix probeset data:

Annotations for 1641637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720