Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641638_at:

>probe:Drosophila_2:1641638_at:123:251; Interrogation_Position=1006; Antisense; CAAGTCAGCGGAGCGTTGAGTTCGA
>probe:Drosophila_2:1641638_at:688:443; Interrogation_Position=1029; Antisense; GATGAGCACGACATCTTCTACGTCT
>probe:Drosophila_2:1641638_at:262:669; Interrogation_Position=1047; Antisense; TACGTCTCACCATCCAAGCGAAAAG
>probe:Drosophila_2:1641638_at:716:223; Interrogation_Position=1069; Antisense; AAGGAGCCACTTCAGTAGGTTCCTC
>probe:Drosophila_2:1641638_at:150:485; Interrogation_Position=1083; Antisense; GTAGGTTCCTCTGGCAATGTGGTAA
>probe:Drosophila_2:1641638_at:466:591; Interrogation_Position=1100; Antisense; TGTGGTAACCTTCTCGAATTTTGTA
>probe:Drosophila_2:1641638_at:599:599; Interrogation_Position=1121; Antisense; TGTAAGTGAACAACGCCTGACGCCC
>probe:Drosophila_2:1641638_at:565:65; Interrogation_Position=1225; Antisense; AGGCCCAACTGGATTTGCAACCGAA
>probe:Drosophila_2:1641638_at:581:563; Interrogation_Position=1253; Antisense; GGCAAGGCCGCTGTACGAGTACAGT
>probe:Drosophila_2:1641638_at:239:393; Interrogation_Position=1285; Antisense; GAAAGCGTAAGACACACACCTACTC
>probe:Drosophila_2:1641638_at:284:277; Interrogation_Position=1332; Antisense; CTTATGAGACTGGAGCGCGAGCGTA
>probe:Drosophila_2:1641638_at:655:235; Interrogation_Position=1356; Antisense; AATCGTAAATTATCGCTGACTGGGA
>probe:Drosophila_2:1641638_at:726:611; Interrogation_Position=1469; Antisense; TGAAACCCCGCTACACTTTGTGTAA
>probe:Drosophila_2:1641638_at:306:305; Interrogation_Position=983; Antisense; CCTGAACGGTGGTGTCGGCATAACA

Paste this into a BLAST search page for me
CAAGTCAGCGGAGCGTTGAGTTCGAGATGAGCACGACATCTTCTACGTCTTACGTCTCACCATCCAAGCGAAAAGAAGGAGCCACTTCAGTAGGTTCCTCGTAGGTTCCTCTGGCAATGTGGTAATGTGGTAACCTTCTCGAATTTTGTATGTAAGTGAACAACGCCTGACGCCCAGGCCCAACTGGATTTGCAACCGAAGGCAAGGCCGCTGTACGAGTACAGTGAAAGCGTAAGACACACACCTACTCCTTATGAGACTGGAGCGCGAGCGTAAATCGTAAATTATCGCTGACTGGGATGAAACCCCGCTACACTTTGTGTAACCTGAACGGTGGTGTCGGCATAACA

Full Affymetrix probeset data:

Annotations for 1641638_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime