FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641639_at:

>probe:Drosophila_2:1641639_at:352:601; Interrogation_Position=1700; Antisense; TGTTCCACCAAAAATTAGTTCCTAG
>probe:Drosophila_2:1641639_at:94:15; Interrogation_Position=1713; Antisense; ATTAGTTCCTAGCTCTCTTAGGCGG
>probe:Drosophila_2:1641639_at:471:215; Interrogation_Position=1742; Antisense; AAGTTCCCGAAACTCCCAGTGCAGA
>probe:Drosophila_2:1641639_at:671:509; Interrogation_Position=1760; Antisense; GTGCAGACACACAACTTCAAGCAGA
>probe:Drosophila_2:1641639_at:236:245; Interrogation_Position=1801; Antisense; AATTTCTAGTCAGCATTTTCTCCCA
>probe:Drosophila_2:1641639_at:449:655; Interrogation_Position=1853; Antisense; TAATTTGTACAATCCGGCAACATTT
>probe:Drosophila_2:1641639_at:413:507; Interrogation_Position=1868; Antisense; GGCAACATTTTTGTAACCACCACCA
>probe:Drosophila_2:1641639_at:565:63; Interrogation_Position=1922; Antisense; ATGTGTGCCCATAATATATCCTAAA
>probe:Drosophila_2:1641639_at:25:483; Interrogation_Position=1962; Antisense; GTATTCTTCGATTTATCCTGTACAT
>probe:Drosophila_2:1641639_at:532:279; Interrogation_Position=1999; Antisense; CTAACTGTAGACTCTAAGCTGAACA
>probe:Drosophila_2:1641639_at:75:391; Interrogation_Position=2027; Antisense; GAAACGCCAGACAATCAATCGTAAG
>probe:Drosophila_2:1641639_at:539:293; Interrogation_Position=2078; Antisense; CGATAGTATTTTTAGCCTAGCTGTA
>probe:Drosophila_2:1641639_at:316:603; Interrogation_Position=2121; Antisense; TGATATGACCACTACTTTTTCGCGT
>probe:Drosophila_2:1641639_at:140:309; Interrogation_Position=2129; Antisense; CCACTACTTTTTCGCGTACACATTG

Paste this into a BLAST search page for me
TGTTCCACCAAAAATTAGTTCCTAGATTAGTTCCTAGCTCTCTTAGGCGGAAGTTCCCGAAACTCCCAGTGCAGAGTGCAGACACACAACTTCAAGCAGAAATTTCTAGTCAGCATTTTCTCCCATAATTTGTACAATCCGGCAACATTTGGCAACATTTTTGTAACCACCACCAATGTGTGCCCATAATATATCCTAAAGTATTCTTCGATTTATCCTGTACATCTAACTGTAGACTCTAAGCTGAACAGAAACGCCAGACAATCAATCGTAAGCGATAGTATTTTTAGCCTAGCTGTATGATATGACCACTACTTTTTCGCGTCCACTACTTTTTCGCGTACACATTG

Full Affymetrix probeset data:

Annotations for 1641639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720