FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641642_at:

>probe:Drosophila_2:1641642_at:57:231; Interrogation_Position=672; Antisense; AATGATCGTCTTACTGCCGAAGTCA
>probe:Drosophila_2:1641642_at:562:451; Interrogation_Position=675; Antisense; GATCGTCTTACTGCCGAAGTCATCC
>probe:Drosophila_2:1641642_at:159:705; Interrogation_Position=682; Antisense; TTACTGCCGAAGTCATCCCAGGGAG
>probe:Drosophila_2:1641642_at:95:283; Interrogation_Position=685; Antisense; CTGCCGAAGTCATCCCAGGGAGTTA
>probe:Drosophila_2:1641642_at:668:373; Interrogation_Position=690; Antisense; GAAGTCATCCCAGGGAGTTAACCTG
>probe:Drosophila_2:1641642_at:597:79; Interrogation_Position=701; Antisense; AGGGAGTTAACCTGGTGCTCTACCA
>probe:Drosophila_2:1641642_at:98:475; Interrogation_Position=706; Antisense; GTTAACCTGGTGCTCTACCAATTGA
>probe:Drosophila_2:1641642_at:521:131; Interrogation_Position=710; Antisense; ACCTGGTGCTCTACCAATTGAAGAA
>probe:Drosophila_2:1641642_at:702:659; Interrogation_Position=863; Antisense; TAACGGATCTGAGGAACGACTTCGC
>probe:Drosophila_2:1641642_at:131:563; Interrogation_Position=875; Antisense; GGAACGACTTCGCAGATCTAGATAA
>probe:Drosophila_2:1641642_at:589:633; Interrogation_Position=884; Antisense; TCGCAGATCTAGATAAATTGCTGAT
>probe:Drosophila_2:1641642_at:305:245; Interrogation_Position=899; Antisense; AATTGCTGATTGCTATCGGTCACAG
>probe:Drosophila_2:1641642_at:455:463; Interrogation_Position=906; Antisense; GATTGCTATCGGTCACAGAGGTGCG
>probe:Drosophila_2:1641642_at:119:43; Interrogation_Position=913; Antisense; ATCGGTCACAGAGGTGCGTGCCTCA

Paste this into a BLAST search page for me
AATGATCGTCTTACTGCCGAAGTCAGATCGTCTTACTGCCGAAGTCATCCTTACTGCCGAAGTCATCCCAGGGAGCTGCCGAAGTCATCCCAGGGAGTTAGAAGTCATCCCAGGGAGTTAACCTGAGGGAGTTAACCTGGTGCTCTACCAGTTAACCTGGTGCTCTACCAATTGAACCTGGTGCTCTACCAATTGAAGAATAACGGATCTGAGGAACGACTTCGCGGAACGACTTCGCAGATCTAGATAATCGCAGATCTAGATAAATTGCTGATAATTGCTGATTGCTATCGGTCACAGGATTGCTATCGGTCACAGAGGTGCGATCGGTCACAGAGGTGCGTGCCTCA

Full Affymetrix probeset data:

Annotations for 1641642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720