FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641646_at:

>probe:Drosophila_2:1641646_at:202:665; Interrogation_Position=1125; Antisense; TTCAAGGCCGCATCGAATGGGTTCG
>probe:Drosophila_2:1641646_at:638:551; Interrogation_Position=1180; Antisense; TAACATTTTTTACAAGGCTTACGCA
>probe:Drosophila_2:1641646_at:258:29; Interrogation_Position=1274; Antisense; ATACTTATTCGATCAATTCACAACT
>probe:Drosophila_2:1641646_at:18:171; Interrogation_Position=1311; Antisense; AAAGGATTTTGCATTCGGAAGATTA
>probe:Drosophila_2:1641646_at:133:657; Interrogation_Position=1405; Antisense; TAATGTCTATTAATGCTGCAGCATC
>probe:Drosophila_2:1641646_at:647:51; Interrogation_Position=1417; Antisense; ATGCTGCAGCATCTGACATGCGATA
>probe:Drosophila_2:1641646_at:686:151; Interrogation_Position=1432; Antisense; ACATGCGATAACACAGTTGTCCTTG
>probe:Drosophila_2:1641646_at:586:467; Interrogation_Position=1447; Antisense; GTTGTCCTTGACCTAGTTGTAGAAC
>probe:Drosophila_2:1641646_at:130:679; Interrogation_Position=1529; Antisense; TATGGCAACGTATGACAGACATTCG
>probe:Drosophila_2:1641646_at:103:403; Interrogation_Position=1546; Antisense; GACATTCGTAATACAAACTTGCGTA
>probe:Drosophila_2:1641646_at:248:345; Interrogation_Position=1574; Antisense; GCATTCAGGAGTTCGCAGTTTTATG
>probe:Drosophila_2:1641646_at:544:39; Interrogation_Position=1606; Antisense; ATCTGATTACATATTTTAGCCTTGG
>probe:Drosophila_2:1641646_at:428:663; Interrogation_Position=1621; Antisense; TTAGCCTTGGTATGTTTTCCCACTG
>probe:Drosophila_2:1641646_at:532:139; Interrogation_Position=1649; Antisense; ACGTGCGAGCGTATCTTGTTTAAAT

Paste this into a BLAST search page for me
TTCAAGGCCGCATCGAATGGGTTCGTAACATTTTTTACAAGGCTTACGCAATACTTATTCGATCAATTCACAACTAAAGGATTTTGCATTCGGAAGATTATAATGTCTATTAATGCTGCAGCATCATGCTGCAGCATCTGACATGCGATAACATGCGATAACACAGTTGTCCTTGGTTGTCCTTGACCTAGTTGTAGAACTATGGCAACGTATGACAGACATTCGGACATTCGTAATACAAACTTGCGTAGCATTCAGGAGTTCGCAGTTTTATGATCTGATTACATATTTTAGCCTTGGTTAGCCTTGGTATGTTTTCCCACTGACGTGCGAGCGTATCTTGTTTAAAT

Full Affymetrix probeset data:

Annotations for 1641646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720