FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641648_at:

>probe:Drosophila_2:1641648_at:55:163; Interrogation_Position=287; Antisense; AAATTTTGGGTTTGCCATCCGCATC
>probe:Drosophila_2:1641648_at:243:395; Interrogation_Position=312; Antisense; GAAATCGCCGCAATCGGAATTTACT
>probe:Drosophila_2:1641648_at:460:565; Interrogation_Position=327; Antisense; GGAATTTACTTGTACACCAGCCAAC
>probe:Drosophila_2:1641648_at:492:633; Interrogation_Position=352; Antisense; TCGCCGTTCAAGACGTCCAAGTTTT
>probe:Drosophila_2:1641648_at:73:39; Interrogation_Position=486; Antisense; ATCTACATCTACTTCTACGGCGAGA
>probe:Drosophila_2:1641648_at:323:319; Interrogation_Position=544; Antisense; GCGTGGCGGCCGAGGAAACTATCAT
>probe:Drosophila_2:1641648_at:212:179; Interrogation_Position=559; Antisense; AAACTATCATGAGTGCCTTTCGCAA
>probe:Drosophila_2:1641648_at:495:559; Interrogation_Position=650; Antisense; GGACAACATGTTCCGAAAGCCGCCA
>probe:Drosophila_2:1641648_at:532:203; Interrogation_Position=666; Antisense; AAGCCGCCATACTCGGTGGAAGGCA
>probe:Drosophila_2:1641648_at:199:27; Interrogation_Position=690; Antisense; ATACCGACCCTTATACGCTGGAAGG
>probe:Drosophila_2:1641648_at:168:529; Interrogation_Position=733; Antisense; GGGATCAGCTGCTCAAGTCGAGTCT
>probe:Drosophila_2:1641648_at:106:219; Interrogation_Position=747; Antisense; AAGTCGAGTCTTCTGGAGCTCTTTT
>probe:Drosophila_2:1641648_at:398:373; Interrogation_Position=791; Antisense; GAAGTCCAATTTTGTCGCCCAATAA
>probe:Drosophila_2:1641648_at:243:663; Interrogation_Position=813; Antisense; TAAAACGCGATTTGGCTTTGGCTTA

Paste this into a BLAST search page for me
AAATTTTGGGTTTGCCATCCGCATCGAAATCGCCGCAATCGGAATTTACTGGAATTTACTTGTACACCAGCCAACTCGCCGTTCAAGACGTCCAAGTTTTATCTACATCTACTTCTACGGCGAGAGCGTGGCGGCCGAGGAAACTATCATAAACTATCATGAGTGCCTTTCGCAAGGACAACATGTTCCGAAAGCCGCCAAAGCCGCCATACTCGGTGGAAGGCAATACCGACCCTTATACGCTGGAAGGGGGATCAGCTGCTCAAGTCGAGTCTAAGTCGAGTCTTCTGGAGCTCTTTTGAAGTCCAATTTTGTCGCCCAATAATAAAACGCGATTTGGCTTTGGCTTA

Full Affymetrix probeset data:

Annotations for 1641648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720