FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641650_at:

>probe:Drosophila_2:1641650_at:79:589; Interrogation_Position=1334; Antisense; TGGAGTACAGCCAGCGTCTGATGAA
>probe:Drosophila_2:1641650_at:239:371; Interrogation_Position=1356; Antisense; GAAGGCCTACTTCGGATATTCGCCA
>probe:Drosophila_2:1641650_at:513:23; Interrogation_Position=1403; Antisense; ATATGCTCGATTTTTATTCCTACAA
>probe:Drosophila_2:1641650_at:266:15; Interrogation_Position=1431; Antisense; ATTTTGGCACGGCTTTAATCGCACC
>probe:Drosophila_2:1641650_at:112:711; Interrogation_Position=1457; Antisense; TTAACGCCAGACTTACCTATGCAAA
>probe:Drosophila_2:1641650_at:141:309; Interrogation_Position=1487; Antisense; CCACATATTACTATCGCTTCGACTT
>probe:Drosophila_2:1641650_at:4:721; Interrogation_Position=1511; Antisense; TTGATTCGCCGAACTTCAACTTCTA
>probe:Drosophila_2:1641650_at:386:273; Interrogation_Position=1530; Antisense; CTTCTACCGGGCTAAATTCTGTGGA
>probe:Drosophila_2:1641650_at:239:243; Interrogation_Position=1560; Antisense; AATTAAGACTGGTGTGGCCCACGCC
>probe:Drosophila_2:1641650_at:290:413; Interrogation_Position=1588; Antisense; GACCTGAGCTATTTGTTCCGGAACG
>probe:Drosophila_2:1641650_at:711:381; Interrogation_Position=1608; Antisense; GAACGCGGGCTCTTGGAAACTGGAT
>probe:Drosophila_2:1641650_at:302:19; Interrogation_Position=1675; Antisense; ATTTGGACGGCATTCGCTGCGACCT
>probe:Drosophila_2:1641650_at:235:9; Interrogation_Position=1709; Antisense; ATTGCCCAGAGATTGGCCACTTGGA
>probe:Drosophila_2:1641650_at:432:369; Interrogation_Position=1752; Antisense; GAATGATCCCAAGCGTGTTATTAAC

Paste this into a BLAST search page for me
TGGAGTACAGCCAGCGTCTGATGAAGAAGGCCTACTTCGGATATTCGCCAATATGCTCGATTTTTATTCCTACAAATTTTGGCACGGCTTTAATCGCACCTTAACGCCAGACTTACCTATGCAAACCACATATTACTATCGCTTCGACTTTTGATTCGCCGAACTTCAACTTCTACTTCTACCGGGCTAAATTCTGTGGAAATTAAGACTGGTGTGGCCCACGCCGACCTGAGCTATTTGTTCCGGAACGGAACGCGGGCTCTTGGAAACTGGATATTTGGACGGCATTCGCTGCGACCTATTGCCCAGAGATTGGCCACTTGGAGAATGATCCCAAGCGTGTTATTAAC

Full Affymetrix probeset data:

Annotations for 1641650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720