FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641651_at:

>probe:Drosophila_2:1641651_at:528:713; Interrogation_Position=120; Antisense; TTGTCCGCCGTGTCCTCGGAGACCA
>probe:Drosophila_2:1641651_at:135:505; Interrogation_Position=131; Antisense; GTCCTCGGAGACCATCCAGCTGCAG
>probe:Drosophila_2:1641651_at:296:581; Interrogation_Position=187; Antisense; TGGCCGAGAACATCCGTGTGTCGCG
>probe:Drosophila_2:1641651_at:638:421; Interrogation_Position=192; Antisense; GAGAACATCCGTGTGTCGCGTGCCG
>probe:Drosophila_2:1641651_at:89:279; Interrogation_Position=218; Antisense; CTACGGAGGATACGGCGCTGCCCCA
>probe:Drosophila_2:1641651_at:155:649; Interrogation_Position=38; Antisense; TCAGCAGCAAGTAGAGACAGCTCAA
>probe:Drosophila_2:1641651_at:483:111; Interrogation_Position=503; Antisense; AGCTCAGTCCTACGGATCCGCCGGT
>probe:Drosophila_2:1641651_at:714:399; Interrogation_Position=53; Antisense; GACAGCTCAAGAACCATCCGCAATG
>probe:Drosophila_2:1641651_at:407:13; Interrogation_Position=563; Antisense; CTTCGTCCGCGAACTTTAAGGATCG
>probe:Drosophila_2:1641651_at:698:545; Interrogation_Position=582; Antisense; GGATCGAAACGAATCTGACTTGACA
>probe:Drosophila_2:1641651_at:37:367; Interrogation_Position=592; Antisense; GAATCTGACTTGACATCTGAACCTA
>probe:Drosophila_2:1641651_at:562:45; Interrogation_Position=68; Antisense; ATCCGCAATGGCATTCAACTTTGGT
>probe:Drosophila_2:1641651_at:720:227; Interrogation_Position=74; Antisense; AATGGCATTCAACTTTGGTCACCTC
>probe:Drosophila_2:1641651_at:522:11; Interrogation_Position=80; Antisense; ATTCAACTTTGGTCACCTCCTCATC

Paste this into a BLAST search page for me
TTGTCCGCCGTGTCCTCGGAGACCAGTCCTCGGAGACCATCCAGCTGCAGTGGCCGAGAACATCCGTGTGTCGCGGAGAACATCCGTGTGTCGCGTGCCGCTACGGAGGATACGGCGCTGCCCCATCAGCAGCAAGTAGAGACAGCTCAAAGCTCAGTCCTACGGATCCGCCGGTGACAGCTCAAGAACCATCCGCAATGCTTCGTCCGCGAACTTTAAGGATCGGGATCGAAACGAATCTGACTTGACAGAATCTGACTTGACATCTGAACCTAATCCGCAATGGCATTCAACTTTGGTAATGGCATTCAACTTTGGTCACCTCATTCAACTTTGGTCACCTCCTCATC

Full Affymetrix probeset data:

Annotations for 1641651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720