Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641653_at:

>probe:Drosophila_2:1641653_at:634:99; Interrogation_Position=1972; Antisense; AGAGATTCACCTTTAAGCGAACTGA
>probe:Drosophila_2:1641653_at:341:209; Interrogation_Position=2077; Antisense; AAGAAATCTGTGACTGCTATTAATA
>probe:Drosophila_2:1641653_at:33:175; Interrogation_Position=2101; Antisense; AAAGCCACAGCTGAGAATTATTCAA
>probe:Drosophila_2:1641653_at:568:661; Interrogation_Position=2136; Antisense; TAAACTAATAGATTTGCCCGCAATT
>probe:Drosophila_2:1641653_at:313:677; Interrogation_Position=2148; Antisense; TTTGCCCGCAATTAACCATAAACTA
>probe:Drosophila_2:1641653_at:423:517; Interrogation_Position=2239; Antisense; GTGTGGCTAAGTCCAATAGGCATGT
>probe:Drosophila_2:1641653_at:326:15; Interrogation_Position=2270; Antisense; ATTATGTTGACCACAAGGCTTCCTC
>probe:Drosophila_2:1641653_at:315:639; Interrogation_Position=2293; Antisense; TCGGGCACCCATGGGTCCGCTAAAG
>probe:Drosophila_2:1641653_at:511:503; Interrogation_Position=2307; Antisense; GTCCGCTAAAGCTGTCTATTCATTC
>probe:Drosophila_2:1641653_at:574:275; Interrogation_Position=2322; Antisense; CTATTCATTCAGTTACACCCAATCG
>probe:Drosophila_2:1641653_at:474:237; Interrogation_Position=2342; Antisense; AATCGATTGATGACCTAGTAACGCA
>probe:Drosophila_2:1641653_at:625:481; Interrogation_Position=2370; Antisense; GTATTTTCTTTTAGTTCGAGCGCAT
>probe:Drosophila_2:1641653_at:218:485; Interrogation_Position=2408; Antisense; GTAGTCATTTTTCTTCTGTGTGTTT
>probe:Drosophila_2:1641653_at:506:175; Interrogation_Position=2488; Antisense; AAACCCAATAAGCTTGTCAGAGCGA

Paste this into a BLAST search page for me
AGAGATTCACCTTTAAGCGAACTGAAAGAAATCTGTGACTGCTATTAATAAAAGCCACAGCTGAGAATTATTCAATAAACTAATAGATTTGCCCGCAATTTTTGCCCGCAATTAACCATAAACTAGTGTGGCTAAGTCCAATAGGCATGTATTATGTTGACCACAAGGCTTCCTCTCGGGCACCCATGGGTCCGCTAAAGGTCCGCTAAAGCTGTCTATTCATTCCTATTCATTCAGTTACACCCAATCGAATCGATTGATGACCTAGTAACGCAGTATTTTCTTTTAGTTCGAGCGCATGTAGTCATTTTTCTTCTGTGTGTTTAAACCCAATAAGCTTGTCAGAGCGA

Full Affymetrix probeset data:

Annotations for 1641653_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime