FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641655_at:

>probe:Drosophila_2:1641655_at:505:583; Interrogation_Position=142; Antisense; TGGCTAGCGGCCAGCAAATTCGCAT
>probe:Drosophila_2:1641655_at:700:355; Interrogation_Position=155; Antisense; GCAAATTCGCATGCTGTCAGTTTCT
>probe:Drosophila_2:1641655_at:508:97; Interrogation_Position=193; Antisense; AGATCTTCAAAGTCCAGAGCGCCGA
>probe:Drosophila_2:1641655_at:460:103; Interrogation_Position=208; Antisense; AGAGCGCCGAGGACTTTGACAAGAA
>probe:Drosophila_2:1641655_at:142:261; Interrogation_Position=249; Antisense; CAGCCCGTGATTGTGGACTTCTTCG
>probe:Drosophila_2:1641655_at:340:557; Interrogation_Position=263; Antisense; GGACTTCTTCGCAACCTGGTGCAAT
>probe:Drosophila_2:1641655_at:51:661; Interrogation_Position=301; Antisense; TAACCCCGCGCATCGAGAGTATTGT
>probe:Drosophila_2:1641655_at:383:601; Interrogation_Position=322; Antisense; TTGTGGGCGAACAGGCCGGTTCCAT
>probe:Drosophila_2:1641655_at:495:325; Interrogation_Position=379; Antisense; GCGAACTGGCTCTGGACTACGATGT
>probe:Drosophila_2:1641655_at:209:625; Interrogation_Position=412; Antisense; TGCCCGTGCTAGTGGTGCTGCAGAA
>probe:Drosophila_2:1641655_at:441:235; Interrogation_Position=53; Antisense; AATCGCTGAACTTTTTGCACTGAGA
>probe:Drosophila_2:1641655_at:360:71; Interrogation_Position=553; Antisense; AGGTTGACCTCCTCGCAAATAAAGC
>probe:Drosophila_2:1641655_at:71:333; Interrogation_Position=576; Antisense; GCTGAGCTTTAGGTTAATTCGGACT
>probe:Drosophila_2:1641655_at:547:153; Interrogation_Position=87; Antisense; AAATAAGCCATGCAGCGACAGATTA

Paste this into a BLAST search page for me
TGGCTAGCGGCCAGCAAATTCGCATGCAAATTCGCATGCTGTCAGTTTCTAGATCTTCAAAGTCCAGAGCGCCGAAGAGCGCCGAGGACTTTGACAAGAACAGCCCGTGATTGTGGACTTCTTCGGGACTTCTTCGCAACCTGGTGCAATTAACCCCGCGCATCGAGAGTATTGTTTGTGGGCGAACAGGCCGGTTCCATGCGAACTGGCTCTGGACTACGATGTTGCCCGTGCTAGTGGTGCTGCAGAAAATCGCTGAACTTTTTGCACTGAGAAGGTTGACCTCCTCGCAAATAAAGCGCTGAGCTTTAGGTTAATTCGGACTAAATAAGCCATGCAGCGACAGATTA

Full Affymetrix probeset data:

Annotations for 1641655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720