Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641659_s_at:

>probe:Drosophila_2:1641659_s_at:578:525; Interrogation_Position=495; Antisense; GGGCACCTTCTGCAACAAGATCGAG
>probe:Drosophila_2:1641659_s_at:559:287; Interrogation_Position=531; Antisense; CGGTCTGACCATCACGCGTGAAATT
>probe:Drosophila_2:1641659_s_at:67:239; Interrogation_Position=573; Antisense; AATCAAGACCAAGACCCCGGCTGTG
>probe:Drosophila_2:1641659_s_at:221:707; Interrogation_Position=683; Antisense; TTACGGCCAAGGATCTCGGCGTGGA
>probe:Drosophila_2:1641659_s_at:150:345; Interrogation_Position=719; Antisense; GCATCGAGGTCATCTCCGTGGAGGA
>probe:Drosophila_2:1641659_s_at:95:309; Interrogation_Position=797; Antisense; CCAAGCTAAAGGAGGGCGGCCACAT
>probe:Drosophila_2:1641659_s_at:59:333; Interrogation_Position=812; Antisense; GCGGCCACATCTAGATGTTCCTCAA
>probe:Drosophila_2:1641659_s_at:262:249; Interrogation_Position=843; Antisense; AATTGTGAGCGCATATTCTACGTTT
>probe:Drosophila_2:1641659_s_at:405:391; Interrogation_Position=889; Antisense; GAAACGTGCATTTATCTAGCCGGAG
>probe:Drosophila_2:1641659_s_at:624:431; Interrogation_Position=913; Antisense; GAGTCGGATTTGCTGACAGGCTTTA
>probe:Drosophila_2:1641659_s_at:146:19; Interrogation_Position=939; Antisense; ATTTCTCTGAATTCAACCCATACCC
>probe:Drosophila_2:1641659_s_at:160:133; Interrogation_Position=954; Antisense; ACCCATACCCGTGTGCTTTAAGTGA
>probe:Drosophila_2:1641659_s_at:658:363; Interrogation_Position=990; Antisense; GAATTTATTCTCGTTGTGTCCAGCT
>probe:Drosophila_2:1641659_s_at:640:281; Interrogation_Position=999; Antisense; CTCGTTGTGTCCAGCTCTAAGAATA

Paste this into a BLAST search page for me
GGGCACCTTCTGCAACAAGATCGAGCGGTCTGACCATCACGCGTGAAATTAATCAAGACCAAGACCCCGGCTGTGTTACGGCCAAGGATCTCGGCGTGGAGCATCGAGGTCATCTCCGTGGAGGACCAAGCTAAAGGAGGGCGGCCACATGCGGCCACATCTAGATGTTCCTCAAAATTGTGAGCGCATATTCTACGTTTGAAACGTGCATTTATCTAGCCGGAGGAGTCGGATTTGCTGACAGGCTTTAATTTCTCTGAATTCAACCCATACCCACCCATACCCGTGTGCTTTAAGTGAGAATTTATTCTCGTTGTGTCCAGCTCTCGTTGTGTCCAGCTCTAAGAATA

Full Affymetrix probeset data:

Annotations for 1641659_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime