FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641660_at:

>probe:Drosophila_2:1641660_at:394:321; Interrogation_Position=1003; Antisense; GCCCGGATGCCGGTCATCATTGGAA
>probe:Drosophila_2:1641660_at:616:35; Interrogation_Position=1018; Antisense; ATCATTGGAAATGTGACGCCGCCCT
>probe:Drosophila_2:1641660_at:707:597; Interrogation_Position=1042; Antisense; TGTCCTGGCAAACTCCTAATGCAAG
>probe:Drosophila_2:1641660_at:263:5; Interrogation_Position=1072; Antisense; ATTGATGGCACTGCTCCGGAACCAA
>probe:Drosophila_2:1641660_at:434:17; Interrogation_Position=1133; Antisense; ATTTTAGCATTTCCACCACATCTTT
>probe:Drosophila_2:1641660_at:40:151; Interrogation_Position=1150; Antisense; ACATCTTTGGCTTCGAATTTCCGGG
>probe:Drosophila_2:1641660_at:494:379; Interrogation_Position=1174; Antisense; GAAGCCGAGTTCATGGTAGCCACCA
>probe:Drosophila_2:1641660_at:601:179; Interrogation_Position=1216; Antisense; AAACATTACTTGTCCGGCGAACAGT
>probe:Drosophila_2:1641660_at:630:103; Interrogation_Position=1249; Antisense; AGACCACGCTATGTCTACTACGAAA
>probe:Drosophila_2:1641660_at:658:723; Interrogation_Position=712; Antisense; TTGACACTTCGCGAGGCGGTGTATT
>probe:Drosophila_2:1641660_at:268:515; Interrogation_Position=730; Antisense; GTGTATTCCCTCGTTCAGATCAGCA
>probe:Drosophila_2:1641660_at:184:113; Interrogation_Position=751; Antisense; AGCACTTACGTTGCCCATCTAAAGA
>probe:Drosophila_2:1641660_at:512:351; Interrogation_Position=864; Antisense; GCAGAATTTTCAGCATCTTCACATG
>probe:Drosophila_2:1641660_at:198:183; Interrogation_Position=986; Antisense; AAAAGCGCTTAATTGCGGCCCGGAT

Paste this into a BLAST search page for me
GCCCGGATGCCGGTCATCATTGGAAATCATTGGAAATGTGACGCCGCCCTTGTCCTGGCAAACTCCTAATGCAAGATTGATGGCACTGCTCCGGAACCAAATTTTAGCATTTCCACCACATCTTTACATCTTTGGCTTCGAATTTCCGGGGAAGCCGAGTTCATGGTAGCCACCAAAACATTACTTGTCCGGCGAACAGTAGACCACGCTATGTCTACTACGAAATTGACACTTCGCGAGGCGGTGTATTGTGTATTCCCTCGTTCAGATCAGCAAGCACTTACGTTGCCCATCTAAAGAGCAGAATTTTCAGCATCTTCACATGAAAAGCGCTTAATTGCGGCCCGGAT

Full Affymetrix probeset data:

Annotations for 1641660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720