FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641661_at:

>probe:Drosophila_2:1641661_at:576:407; Interrogation_Position=1071; Antisense; GACGGGTCTAAATACTCGCAGTGGA
>probe:Drosophila_2:1641661_at:726:231; Interrogation_Position=1101; Antisense; AATGCAGTTTCTCAAGTATGGCTTC
>probe:Drosophila_2:1641661_at:639:701; Interrogation_Position=1134; Antisense; TTTTGTGCCACATTACGACTATTTC
>probe:Drosophila_2:1641661_at:516:251; Interrogation_Position=1158; Antisense; CAACTCGAAAACCTTCTCTTTGGAG
>probe:Drosophila_2:1641661_at:416:313; Interrogation_Position=1201; Antisense; GCCACGGTGCTCTTTTATCTTAATA
>probe:Drosophila_2:1641661_at:247:587; Interrogation_Position=1239; Antisense; TGGAGCCACAGTTTTCCCCAAATTA
>probe:Drosophila_2:1641661_at:639:13; Interrogation_Position=1260; Antisense; ATTAAATCTTGCTGTGCCAACCCAA
>probe:Drosophila_2:1641661_at:113:169; Interrogation_Position=1284; Antisense; AAAGGGTTCGGCATTGTTCTGGCAC
>probe:Drosophila_2:1641661_at:610:213; Interrogation_Position=1321; Antisense; AAGTCCTACGACTACGATACACGCA
>probe:Drosophila_2:1641661_at:640:29; Interrogation_Position=1337; Antisense; ATACACGCACTTTCCATGGCGCATG
>probe:Drosophila_2:1641661_at:674:269; Interrogation_Position=1358; Antisense; CATGTCCTCTGATATCTGGCACAAA
>probe:Drosophila_2:1641661_at:530:371; Interrogation_Position=829; Antisense; GAAGAACTTTCTTTGGATCCGTATG
>probe:Drosophila_2:1641661_at:13:205; Interrogation_Position=913; Antisense; AAGCCATTCCTGGAGCGTGCGAAAG
>probe:Drosophila_2:1641661_at:80:679; Interrogation_Position=978; Antisense; TAGATCAGCAGATGGCGCTTGGCTT

Paste this into a BLAST search page for me
GACGGGTCTAAATACTCGCAGTGGAAATGCAGTTTCTCAAGTATGGCTTCTTTTGTGCCACATTACGACTATTTCCAACTCGAAAACCTTCTCTTTGGAGGCCACGGTGCTCTTTTATCTTAATATGGAGCCACAGTTTTCCCCAAATTAATTAAATCTTGCTGTGCCAACCCAAAAAGGGTTCGGCATTGTTCTGGCACAAGTCCTACGACTACGATACACGCAATACACGCACTTTCCATGGCGCATGCATGTCCTCTGATATCTGGCACAAAGAAGAACTTTCTTTGGATCCGTATGAAGCCATTCCTGGAGCGTGCGAAAGTAGATCAGCAGATGGCGCTTGGCTT

Full Affymetrix probeset data:

Annotations for 1641661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720