FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641662_at:

>probe:Drosophila_2:1641662_at:320:183; Interrogation_Position=1489; Antisense; AACAACGGCTCGTGTCTATACGTTC
>probe:Drosophila_2:1641662_at:576:715; Interrogation_Position=1591; Antisense; TTCGGCAGTTGGACCTACGACGGAT
>probe:Drosophila_2:1641662_at:202:9; Interrogation_Position=1614; Antisense; ATTCCAGGTTTGGTTCAGTGTGCCC
>probe:Drosophila_2:1641662_at:41:517; Interrogation_Position=1631; Antisense; GTGTGCCCGGCAAACGTAACGAAAT
>probe:Drosophila_2:1641662_at:491:395; Interrogation_Position=1651; Antisense; GAAATCTATTACAACTGCTGCCCGG
>probe:Drosophila_2:1641662_at:314:619; Interrogation_Position=1666; Antisense; TGCTGCCCGGAACCCTATATAGACA
>probe:Drosophila_2:1641662_at:273:687; Interrogation_Position=1681; Antisense; TATATAGACATCACCTTCGCCATCA
>probe:Drosophila_2:1641662_at:380:185; Interrogation_Position=1719; Antisense; AACACTGTACTATTTCTTCAACCTG
>probe:Drosophila_2:1641662_at:622:27; Interrogation_Position=1747; Antisense; ATACCTTGTGTACTGATTGCCTCCA
>probe:Drosophila_2:1641662_at:344:281; Interrogation_Position=1790; Antisense; CTCTGCCGCCAGATTCGGGTGAAAA
>probe:Drosophila_2:1641662_at:284:591; Interrogation_Position=1853; Antisense; TGGTAGCTTCATCCGTTGTGTCAAC
>probe:Drosophila_2:1641662_at:525:163; Interrogation_Position=1978; Antisense; AAATTTGCAGCTATGGTCGTTGACA
>probe:Drosophila_2:1641662_at:639:399; Interrogation_Position=1999; Antisense; GACAGACTGTGCCTTATCATATTCA
>probe:Drosophila_2:1641662_at:441:285; Interrogation_Position=2051; Antisense; CTGTACTACTATCAGCACCACATAT

Paste this into a BLAST search page for me
AACAACGGCTCGTGTCTATACGTTCTTCGGCAGTTGGACCTACGACGGATATTCCAGGTTTGGTTCAGTGTGCCCGTGTGCCCGGCAAACGTAACGAAATGAAATCTATTACAACTGCTGCCCGGTGCTGCCCGGAACCCTATATAGACATATATAGACATCACCTTCGCCATCAAACACTGTACTATTTCTTCAACCTGATACCTTGTGTACTGATTGCCTCCACTCTGCCGCCAGATTCGGGTGAAAATGGTAGCTTCATCCGTTGTGTCAACAAATTTGCAGCTATGGTCGTTGACAGACAGACTGTGCCTTATCATATTCACTGTACTACTATCAGCACCACATAT

Full Affymetrix probeset data:

Annotations for 1641662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720