FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641663_at:

>probe:Drosophila_2:1641663_at:475:41; Interrogation_Position=117; Antisense; ATCGGGACTCGGACTAGGATCCTCA
>probe:Drosophila_2:1641663_at:367:527; Interrogation_Position=120; Antisense; GGGACTCGGACTAGGATCCTCATCG
>probe:Drosophila_2:1641663_at:557:557; Interrogation_Position=127; Antisense; GGACTAGGATCCTCATCGCGGTTCG
>probe:Drosophila_2:1641663_at:303:53; Interrogation_Position=13; Antisense; ATGCATTTTGTCACACAGCAACGGG
>probe:Drosophila_2:1641663_at:17:679; Interrogation_Position=131; Antisense; TAGGATCCTCATCGCGGTTCGCCGC
>probe:Drosophila_2:1641663_at:129:17; Interrogation_Position=17; Antisense; ATTTTGTCACACAGCAACGGGCACA
>probe:Drosophila_2:1641663_at:367:81; Interrogation_Position=176; Antisense; AGGGTGCCCTGCCCAAGTCCTTGGC
>probe:Drosophila_2:1641663_at:496:599; Interrogation_Position=21; Antisense; TGTCACACAGCAACGGGCACAACAG
>probe:Drosophila_2:1641663_at:686:41; Interrogation_Position=221; Antisense; ATCGTCCTTCGTCCACGCAGGGCAA
>probe:Drosophila_2:1641663_at:72:505; Interrogation_Position=224; Antisense; GTCCTTCGTCCACGCAGGGCAAGCA
>probe:Drosophila_2:1641663_at:40:83; Interrogation_Position=239; Antisense; AGGGCAAGCACAAGCGCACCGCCAG
>probe:Drosophila_2:1641663_at:324:205; Interrogation_Position=250; Antisense; AAGCGCACCGCCAGCCTAAATGCGA
>probe:Drosophila_2:1641663_at:145:263; Interrogation_Position=261; Antisense; CAGCCTAAATGCGACGCTCATGTGA
>probe:Drosophila_2:1641663_at:30:93; Interrogation_Position=94; Antisense; AGTTCCTCGTGCTCCGGATCGGGAT

Paste this into a BLAST search page for me
ATCGGGACTCGGACTAGGATCCTCAGGGACTCGGACTAGGATCCTCATCGGGACTAGGATCCTCATCGCGGTTCGATGCATTTTGTCACACAGCAACGGGTAGGATCCTCATCGCGGTTCGCCGCATTTTGTCACACAGCAACGGGCACAAGGGTGCCCTGCCCAAGTCCTTGGCTGTCACACAGCAACGGGCACAACAGATCGTCCTTCGTCCACGCAGGGCAAGTCCTTCGTCCACGCAGGGCAAGCAAGGGCAAGCACAAGCGCACCGCCAGAAGCGCACCGCCAGCCTAAATGCGACAGCCTAAATGCGACGCTCATGTGAAGTTCCTCGTGCTCCGGATCGGGAT

Full Affymetrix probeset data:

Annotations for 1641663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720