Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641664_at:

>probe:Drosophila_2:1641664_at:450:23; Interrogation_Position=1050; Antisense; ATATGTGATCGAACAACCTCCTCAG
>probe:Drosophila_2:1641664_at:560:667; Interrogation_Position=1098; Antisense; TACTCGGCTATTCATCACAAACGGG
>probe:Drosophila_2:1641664_at:168:433; Interrogation_Position=1157; Antisense; GAGTGCCGATCTTGGGATTGCCTGT
>probe:Drosophila_2:1641664_at:485:7; Interrogation_Position=1173; Antisense; ATTGCCTGTGTTCTTCGATCAGTTT
>probe:Drosophila_2:1641664_at:332:59; Interrogation_Position=1211; Antisense; ATGTTAATCTGCGTGGCATGGCCGA
>probe:Drosophila_2:1641664_at:205:285; Interrogation_Position=1270; Antisense; CTGACCTCAACTATTCGGAAGCTGC
>probe:Drosophila_2:1641664_at:78:389; Interrogation_Position=1326; Antisense; GAAAATGTCGCAATCCTTCAGGGAT
>probe:Drosophila_2:1641664_at:665:441; Interrogation_Position=1348; Antisense; GATCGACCCATGAGTCCTTTGGACA
>probe:Drosophila_2:1641664_at:615:151; Interrogation_Position=1419; Antisense; ACATATGCGCCTTAACACGGAGGAT
>probe:Drosophila_2:1641664_at:173:547; Interrogation_Position=1440; Antisense; GGATGTTCCTCTTTACTACGAATGG
>probe:Drosophila_2:1641664_at:543:297; Interrogation_Position=1489; Antisense; CGCTTTGGTATTGTCTTTGGGTCTG
>probe:Drosophila_2:1641664_at:286:727; Interrogation_Position=1505; Antisense; TTGGGTCTGTGATCTACTTGGTCTA
>probe:Drosophila_2:1641664_at:638:561; Interrogation_Position=1579; Antisense; GGAACTGTTTCTCAACATCCTAGCT
>probe:Drosophila_2:1641664_at:50:189; Interrogation_Position=1592; Antisense; AACATCCTAGCTTGCTTGATCGAAG

Paste this into a BLAST search page for me
ATATGTGATCGAACAACCTCCTCAGTACTCGGCTATTCATCACAAACGGGGAGTGCCGATCTTGGGATTGCCTGTATTGCCTGTGTTCTTCGATCAGTTTATGTTAATCTGCGTGGCATGGCCGACTGACCTCAACTATTCGGAAGCTGCGAAAATGTCGCAATCCTTCAGGGATGATCGACCCATGAGTCCTTTGGACAACATATGCGCCTTAACACGGAGGATGGATGTTCCTCTTTACTACGAATGGCGCTTTGGTATTGTCTTTGGGTCTGTTGGGTCTGTGATCTACTTGGTCTAGGAACTGTTTCTCAACATCCTAGCTAACATCCTAGCTTGCTTGATCGAAG

Full Affymetrix probeset data:

Annotations for 1641664_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime