Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641671_at:

>probe:Drosophila_2:1641671_at:619:647; Interrogation_Position=1328; Antisense; TCAAATATCTTGGTTCCTTTAGCCC
>probe:Drosophila_2:1641671_at:539:641; Interrogation_Position=1354; Antisense; TCTCAGAATCCCTTGTTCATTGACT
>probe:Drosophila_2:1641671_at:653:169; Interrogation_Position=1410; Antisense; AAAGGTGCGCAGCTACTTCAAGTAC
>probe:Drosophila_2:1641671_at:14:341; Interrogation_Position=1421; Antisense; GCTACTTCAAGTACACCACCATTAT
>probe:Drosophila_2:1641671_at:45:129; Interrogation_Position=1435; Antisense; ACCACCATTATACTTGGAATCTCAG
>probe:Drosophila_2:1641671_at:157:281; Interrogation_Position=1455; Antisense; CTCAGTTTTCATTTGCCTCAAGTGC
>probe:Drosophila_2:1641671_at:682:315; Interrogation_Position=1469; Antisense; GCCTCAAGTGCAAGTGGTTCTCATA
>probe:Drosophila_2:1641671_at:130:85; Interrogation_Position=1481; Antisense; AGTGGTTCTCATAGTATCCGCTCAA
>probe:Drosophila_2:1641671_at:479:629; Interrogation_Position=1497; Antisense; TCCGCTCAAGAACATTCCTCATATT
>probe:Drosophila_2:1641671_at:177:307; Interrogation_Position=1513; Antisense; CCTCATATTATTTCCAACGTTTACG
>probe:Drosophila_2:1641671_at:152:383; Interrogation_Position=1540; Antisense; GAACGTGGTTTTCCTTACCGCTCTG
>probe:Drosophila_2:1641671_at:530:673; Interrogation_Position=1555; Antisense; TACCGCTCTGAACTGGCGGAATTTT
>probe:Drosophila_2:1641671_at:190:561; Interrogation_Position=1666; Antisense; GGAAACGCGTAATCTCTCAATACAT
>probe:Drosophila_2:1641671_at:115:685; Interrogation_Position=1741; Antisense; TATATCAAACGTTACCTCAAAGCTG

Paste this into a BLAST search page for me
TCAAATATCTTGGTTCCTTTAGCCCTCTCAGAATCCCTTGTTCATTGACTAAAGGTGCGCAGCTACTTCAAGTACGCTACTTCAAGTACACCACCATTATACCACCATTATACTTGGAATCTCAGCTCAGTTTTCATTTGCCTCAAGTGCGCCTCAAGTGCAAGTGGTTCTCATAAGTGGTTCTCATAGTATCCGCTCAATCCGCTCAAGAACATTCCTCATATTCCTCATATTATTTCCAACGTTTACGGAACGTGGTTTTCCTTACCGCTCTGTACCGCTCTGAACTGGCGGAATTTTGGAAACGCGTAATCTCTCAATACATTATATCAAACGTTACCTCAAAGCTG

Full Affymetrix probeset data:

Annotations for 1641671_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime